Incidental Mutation 'R4649:Zfp462'
ID350569
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Namezinc finger protein 462
SynonymsZfpip, 9430078C22Rik, Gt4-2
MMRRC Submission 041910-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R4649 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location54945048-55083563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55009349 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 438 (N438K)
Ref Sequence ENSEMBL: ENSMUSP00000095677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070] [ENSMUST00000133895]
Predicted Effect probably benign
Transcript: ENSMUST00000030131
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079605
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098070
AA Change: N438K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206
AA Change: N438K

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133895
SMART Domains Protein: ENSMUSP00000122775
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,169,893 V841F probably damaging Het
Adcy10 G A 1: 165,504,049 E84K probably damaging Het
Adgrg6 C A 10: 14,468,827 M127I probably damaging Het
Agpat5 A G 8: 18,879,652 I266V possibly damaging Het
Agtpbp1 A T 13: 59,528,399 Y186N possibly damaging Het
Alx1 A T 10: 103,009,332 N279K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Arsi A G 18: 60,917,098 Y351C probably damaging Het
B4galnt3 T A 6: 120,224,620 R155W probably damaging Het
BC028528 T C 3: 95,888,265 E75G probably damaging Het
Bmp2k C T 5: 97,053,111 P297S possibly damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Bzw2 A T 12: 36,123,981 V98E probably null Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Cd19 A G 7: 126,414,492 S42P probably benign Het
Chml A G 1: 175,687,396 S138P probably benign Het
Clic6 T G 16: 92,530,939 probably null Het
Col12a1 A T 9: 79,639,794 V2252E probably damaging Het
Cplx2 G A 13: 54,379,548 E82K probably benign Het
Csmd2 G A 4: 128,546,073 V3107M probably benign Het
Cspg4 T A 9: 56,886,865 V628D possibly damaging Het
Dcaf13 G A 15: 39,138,242 R315Q possibly damaging Het
Deaf1 A G 7: 141,297,573 V547A possibly damaging Het
Dmxl1 C T 18: 49,878,631 T1285I probably damaging Het
Dnah3 C A 7: 120,047,698 W1036L probably damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dsg2 T A 18: 20,602,245 D1093E possibly damaging Het
Edaradd T A 13: 12,508,423 H12L probably damaging Het
Enam T C 5: 88,492,968 M163T probably benign Het
Fbxo22 T A 9: 55,221,049 V218E probably damaging Het
Fbxo34 A T 14: 47,529,628 K148N probably damaging Het
Foxi3 A G 6: 70,956,976 D149G probably damaging Het
Gbp8 C T 5: 105,041,941 G75D probably damaging Het
Gm10784 C T 13: 49,945,215 noncoding transcript Het
Gm11127 T C 17: 36,057,876 Y104C possibly damaging Het
Gm7247 G A 14: 51,569,594 probably null Het
Grik3 T A 4: 125,650,485 V333E probably damaging Het
Gsap A T 5: 21,226,311 D211V probably damaging Het
Ino80 T C 2: 119,431,008 N725S probably damaging Het
Itgad A G 7: 128,189,531 I443V probably benign Het
Itsn1 T A 16: 91,841,588 I52N probably damaging Het
Kmt2b TCTCCTCCTCCTCCTCCTCCTCCTCC TCTCCTCCTCCTCCTCCTCCTCC 7: 30,586,358 probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Lyn C A 4: 3,738,850 Q41K probably benign Het
Mapk13 C T 17: 28,778,487 R360* probably null Het
Mapk8ip3 T A 17: 24,904,752 I599F probably damaging Het
Me1 T C 9: 86,679,852 K60R probably benign Het
Mga T A 2: 119,941,493 D1532E possibly damaging Het
Miga1 G A 3: 152,279,005 S427L probably benign Het
Mknk2 A T 10: 80,669,339 V186E probably damaging Het
Myo1a C A 10: 127,710,217 N236K probably benign Het
Myt1 A G 2: 181,797,414 D243G probably benign Het
Ncf4 T C 15: 78,255,989 V196A possibly damaging Het
Nlrp5 G T 7: 23,418,178 L442F probably damaging Het
Olfm4 G A 14: 80,021,307 D332N probably benign Het
Olfr1254 C A 2: 89,789,293 V20F probably benign Het
Olfr32 T A 2: 90,139,088 D17V probably damaging Het
Osbpl11 T A 16: 33,196,082 M69K probably benign Het
Oxnad1 T A 14: 32,102,409 *312K probably null Het
Plekhg1 A G 10: 3,956,985 Q634R probably benign Het
Plekhh2 T C 17: 84,575,263 Y733H probably damaging Het
Ppp1r21 A G 17: 88,549,513 H132R probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pudp T C 18: 50,568,188 D158G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Ranbp3 T A 17: 56,696,640 probably null Het
Ranbp6 A G 19: 29,810,321 V877A probably benign Het
Rgsl1 A T 1: 153,817,582 S618T probably benign Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rhox2a A T X: 37,245,362 I61L probably benign Het
Rnf207 A C 4: 152,312,155 D466E probably benign Het
Rnf7 A G 9: 96,471,830 I80T probably benign Het
Ros1 T A 10: 52,129,668 I878F possibly damaging Het
Rsbn1 T A 3: 103,953,780 probably null Het
Sbk1 T C 7: 126,291,129 S105P probably damaging Het
Sdk1 T C 5: 142,006,625 Y790H probably damaging Het
Sec62 T A 3: 30,810,534 N182K unknown Het
Slc15a1 T C 14: 121,478,092 Y345C probably damaging Het
Slc27a1 G A 8: 71,570,764 A15T probably benign Het
Slc35d1 A G 4: 103,213,229 F110L probably damaging Het
Slc39a5 T A 10: 128,397,267 S333C probably benign Het
Tarbp1 A G 8: 126,447,195 S927P probably damaging Het
Tns1 A G 1: 73,953,771 S583P probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trim40 T C 17: 36,882,639 probably null Het
Trim42 C A 9: 97,362,945 V601L probably benign Het
Trpc7 G A 13: 56,887,554 R189C probably damaging Het
Ttc29 A T 8: 78,333,579 Y376F probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vmn2r68 C A 7: 85,221,535 A847S probably benign Het
Wdr63 A G 3: 146,048,167 S713P probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Zfat A G 15: 68,184,476 Y237H probably damaging Het
Zfp236 A T 18: 82,597,659 W1840R probably damaging Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp952 T A 17: 33,002,925 V88E probably damaging Het
Znfx1 G T 2: 167,056,356 A216D probably benign Het
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55011483 unclassified probably null
IGL00421:Zfp462 APN 4 55023576 missense probably benign 0.00
IGL00899:Zfp462 APN 4 55007732 missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55013181 missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55008912 missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55008586 missense probably benign 0.20
IGL01862:Zfp462 APN 4 55023441 missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55012138 missense probably benign 0.04
IGL02029:Zfp462 APN 4 55079395 splice site probably benign
IGL02338:Zfp462 APN 4 55010292 missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55012986 missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55060236 missense probably null 1.00
IGL02815:Zfp462 APN 4 55051303 missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55080785 missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55009757 unclassified probably benign
FR4304:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009761 unclassified probably benign
P0035:Zfp462 UTSW 4 55009086 missense probably benign
R0052:Zfp462 UTSW 4 55011762 missense probably benign 0.03
R0143:Zfp462 UTSW 4 55023402 splice site probably benign
R0145:Zfp462 UTSW 4 55010529 missense probably damaging 1.00
R0315:Zfp462 UTSW 4 55079314 missense probably damaging 0.99
R0349:Zfp462 UTSW 4 55008768 missense probably benign
R0359:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0413:Zfp462 UTSW 4 55010534 missense probably damaging 0.99
R0554:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55011951 missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55007563 start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55013000 missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55060046 missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55007667 missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55009002 missense probably benign
R1541:Zfp462 UTSW 4 55008928 missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55013489 missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55010010 missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55010830 missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55008496 missense probably benign 0.00
R2148:Zfp462 UTSW 4 55013670 missense probably benign 0.01
R2179:Zfp462 UTSW 4 55009524 missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55013712 missense probably benign
R2352:Zfp462 UTSW 4 55008313 missense probably null
R2566:Zfp462 UTSW 4 55008522 missense probably benign 0.00
R3879:Zfp462 UTSW 4 55060095 missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55012402 missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55008411 missense probably benign 0.00
R4413:Zfp462 UTSW 4 55012672 missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55011889 missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55012981 missense probably damaging 1.00
R4682:Zfp462 UTSW 4 55011376 missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55008612 missense probably benign
R4744:Zfp462 UTSW 4 55011598 missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55013476 missense probably benign 0.00
R4819:Zfp462 UTSW 4 55060044 missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55012213 missense probably damaging 1.00
R4854:Zfp462 UTSW 4 55010668 missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55009444 missense probably benign 0.02
R4891:Zfp462 UTSW 4 55060055 missense probably damaging 1.00
R4993:Zfp462 UTSW 4 55051204 missense possibly damaging 0.62
R5118:Zfp462 UTSW 4 55010667 missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55016986 splice site probably null
R5173:Zfp462 UTSW 4 55011115 missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55016887 missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55012299 missense probably benign
R5314:Zfp462 UTSW 4 55013178 missense probably damaging 1.00
R5429:Zfp462 UTSW 4 55060077 missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55009818 missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55050281 missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55013464 missense probably benign 0.01
R5775:Zfp462 UTSW 4 55010590 missense probably damaging 0.99
R6126:Zfp462 UTSW 4 55023573 missense probably benign 0.01
R6280:Zfp462 UTSW 4 55010253 missense probably benign 0.00
R6325:Zfp462 UTSW 4 55080680 missense probably benign 0.04
R6542:Zfp462 UTSW 4 55023433 missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55012324 unclassified probably null
R6663:Zfp462 UTSW 4 55008933 missense possibly damaging 0.53
R6872:Zfp462 UTSW 4 55012326 missense probably benign 0.01
R6889:Zfp462 UTSW 4 55007671 missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55009544 missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55007775 missense probably benign 0.25
R6988:Zfp462 UTSW 4 55080716 missense probably benign 0.00
R7131:Zfp462 UTSW 4 55009380 missense probably benign
R7151:Zfp462 UTSW 4 55051271 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATCTGCTGACCTGGACAC -3'
(R):5'- CGCTTTGAGAATTCACAGTATCCC -3'

Sequencing Primer
(F):5'- TCTGCTGACCTGGACACTAACAG -3'
(R):5'- TTGAGAATTCACAGTATCCCAATCCG -3'
Posted On2015-10-08