Incidental Mutation 'R4649:Slc35d1'
ID350571
Institutional Source Beutler Lab
Gene Symbol Slc35d1
Ensembl Gene ENSMUSG00000028521
Gene Namesolute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1
SynonymsUGTREL7
MMRRC Submission 041910-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4649 (G1)
Quality Score224
Status Not validated
Chromosome4
Chromosomal Location103170649-103215164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103213229 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 110 (F110L)
Ref Sequence ENSEMBL: ENSMUSP00000122124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036195] [ENSMUST00000150285] [ENSMUST00000183432]
Predicted Effect probably benign
Transcript: ENSMUST00000036195
AA Change: F89L

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000037617
Gene: ENSMUSG00000028521
AA Change: F89L

DomainStartEndE-ValueType
Pfam:TPT 18 307 6.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094947
SMART Domains Protein: ENSMUSP00000092554
Gene: ENSMUSG00000028521

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 58 N/A INTRINSIC
transmembrane domain 107 124 N/A INTRINSIC
transmembrane domain 128 147 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150285
AA Change: F110L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122124
Gene: ENSMUSG00000028521
AA Change: F110L

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 69 88 N/A INTRINSIC
transmembrane domain 158 177 N/A INTRINSIC
transmembrane domain 187 205 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 259 281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154845
Predicted Effect probably benign
Transcript: ENSMUST00000183432
AA Change: F89L

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138926
Gene: ENSMUSG00000028521
AA Change: F89L

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 50 69 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
transmembrane domain 138 157 N/A INTRINSIC
transmembrane domain 167 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204816
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of cellular glycoconjugates occurs in the endoplasmic reticulum (ER) and Golgi compartment, and requires transport of nucleotide sugars from the cytosol into the lumen of the ER and Golgi by specific transporters. The protein encoded by this gene resides in the ER, and transports both UDP-glucuronic acid (UDP-GlcA) and UDP-N-acetylgalactosamine (UDP-GalNAc) from the cytoplasm to the ER lumen. It may participate in glucuronidation and/or chondroitin sulfate biosynthesis. Mutations in this gene are associated with Schneckenbecken dysplasia.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality and chondrodystrophy associated with impaired chondroitin sulfate biosynthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,169,893 V841F probably damaging Het
Adcy10 G A 1: 165,504,049 E84K probably damaging Het
Adgrg6 C A 10: 14,468,827 M127I probably damaging Het
Agpat5 A G 8: 18,879,652 I266V possibly damaging Het
Agtpbp1 A T 13: 59,528,399 Y186N possibly damaging Het
Alx1 A T 10: 103,009,332 N279K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Arsi A G 18: 60,917,098 Y351C probably damaging Het
B4galnt3 T A 6: 120,224,620 R155W probably damaging Het
BC028528 T C 3: 95,888,265 E75G probably damaging Het
Bmp2k C T 5: 97,053,111 P297S possibly damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Bzw2 A T 12: 36,123,981 V98E probably null Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Cd19 A G 7: 126,414,492 S42P probably benign Het
Chml A G 1: 175,687,396 S138P probably benign Het
Clic6 T G 16: 92,530,939 probably null Het
Col12a1 A T 9: 79,639,794 V2252E probably damaging Het
Cplx2 G A 13: 54,379,548 E82K probably benign Het
Csmd2 G A 4: 128,546,073 V3107M probably benign Het
Cspg4 T A 9: 56,886,865 V628D possibly damaging Het
Dcaf13 G A 15: 39,138,242 R315Q possibly damaging Het
Deaf1 A G 7: 141,297,573 V547A possibly damaging Het
Dmxl1 C T 18: 49,878,631 T1285I probably damaging Het
Dnah3 C A 7: 120,047,698 W1036L probably damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dsg2 T A 18: 20,602,245 D1093E possibly damaging Het
Edaradd T A 13: 12,508,423 H12L probably damaging Het
Enam T C 5: 88,492,968 M163T probably benign Het
Fbxo22 T A 9: 55,221,049 V218E probably damaging Het
Fbxo34 A T 14: 47,529,628 K148N probably damaging Het
Foxi3 A G 6: 70,956,976 D149G probably damaging Het
Gbp8 C T 5: 105,041,941 G75D probably damaging Het
Gm10784 C T 13: 49,945,215 noncoding transcript Het
Gm11127 T C 17: 36,057,876 Y104C possibly damaging Het
Gm7247 G A 14: 51,569,594 probably null Het
Grik3 T A 4: 125,650,485 V333E probably damaging Het
Gsap A T 5: 21,226,311 D211V probably damaging Het
Ino80 T C 2: 119,431,008 N725S probably damaging Het
Itgad A G 7: 128,189,531 I443V probably benign Het
Itsn1 T A 16: 91,841,588 I52N probably damaging Het
Kmt2b TCTCCTCCTCCTCCTCCTCCTCCTCC TCTCCTCCTCCTCCTCCTCCTCC 7: 30,586,358 probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Lyn C A 4: 3,738,850 Q41K probably benign Het
Mapk13 C T 17: 28,778,487 R360* probably null Het
Mapk8ip3 T A 17: 24,904,752 I599F probably damaging Het
Me1 T C 9: 86,679,852 K60R probably benign Het
Mga T A 2: 119,941,493 D1532E possibly damaging Het
Miga1 G A 3: 152,279,005 S427L probably benign Het
Mknk2 A T 10: 80,669,339 V186E probably damaging Het
Myo1a C A 10: 127,710,217 N236K probably benign Het
Myt1 A G 2: 181,797,414 D243G probably benign Het
Ncf4 T C 15: 78,255,989 V196A possibly damaging Het
Nlrp5 G T 7: 23,418,178 L442F probably damaging Het
Olfm4 G A 14: 80,021,307 D332N probably benign Het
Olfr1254 C A 2: 89,789,293 V20F probably benign Het
Olfr32 T A 2: 90,139,088 D17V probably damaging Het
Osbpl11 T A 16: 33,196,082 M69K probably benign Het
Oxnad1 T A 14: 32,102,409 *312K probably null Het
Plekhg1 A G 10: 3,956,985 Q634R probably benign Het
Plekhh2 T C 17: 84,575,263 Y733H probably damaging Het
Ppp1r21 A G 17: 88,549,513 H132R probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pudp T C 18: 50,568,188 D158G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Ranbp3 T A 17: 56,696,640 probably null Het
Ranbp6 A G 19: 29,810,321 V877A probably benign Het
Rgsl1 A T 1: 153,817,582 S618T probably benign Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rhox2a A T X: 37,245,362 I61L probably benign Het
Rnf207 A C 4: 152,312,155 D466E probably benign Het
Rnf7 A G 9: 96,471,830 I80T probably benign Het
Ros1 T A 10: 52,129,668 I878F possibly damaging Het
Rsbn1 T A 3: 103,953,780 probably null Het
Sbk1 T C 7: 126,291,129 S105P probably damaging Het
Sdk1 T C 5: 142,006,625 Y790H probably damaging Het
Sec62 T A 3: 30,810,534 N182K unknown Het
Slc15a1 T C 14: 121,478,092 Y345C probably damaging Het
Slc27a1 G A 8: 71,570,764 A15T probably benign Het
Slc39a5 T A 10: 128,397,267 S333C probably benign Het
Tarbp1 A G 8: 126,447,195 S927P probably damaging Het
Tns1 A G 1: 73,953,771 S583P probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trim40 T C 17: 36,882,639 probably null Het
Trim42 C A 9: 97,362,945 V601L probably benign Het
Trpc7 G A 13: 56,887,554 R189C probably damaging Het
Ttc29 A T 8: 78,333,579 Y376F probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vmn2r68 C A 7: 85,221,535 A847S probably benign Het
Wdr63 A G 3: 146,048,167 S713P probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Zfat A G 15: 68,184,476 Y237H probably damaging Het
Zfp236 A T 18: 82,597,659 W1840R probably damaging Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp462 T A 4: 55,009,349 N438K probably benign Het
Zfp952 T A 17: 33,002,925 V88E probably damaging Het
Znfx1 G T 2: 167,056,356 A216D probably benign Het
Other mutations in Slc35d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Slc35d1 APN 4 103211325 missense probably benign 0.00
IGL03198:Slc35d1 APN 4 103184888 missense probably damaging 1.00
R0131:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0131:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0132:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0206:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0206:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0208:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0270:Slc35d1 UTSW 4 103190838 missense probably damaging 0.98
R0346:Slc35d1 UTSW 4 103190847 missense probably damaging 0.96
R0388:Slc35d1 UTSW 4 103184887 nonsense probably null
R0638:Slc35d1 UTSW 4 103213244 splice site probably benign
R2146:Slc35d1 UTSW 4 103205152 missense probably damaging 0.99
R3722:Slc35d1 UTSW 4 103208124 missense possibly damaging 0.93
R5137:Slc35d1 UTSW 4 103214781 missense possibly damaging 0.71
R5327:Slc35d1 UTSW 4 103213186 missense probably damaging 1.00
R5351:Slc35d1 UTSW 4 103189839 missense probably damaging 1.00
R5395:Slc35d1 UTSW 4 103211375 critical splice acceptor site probably null
R6263:Slc35d1 UTSW 4 103208168 missense possibly damaging 0.93
R6470:Slc35d1 UTSW 4 103189822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAGTGGAAACGTCCTGGTG -3'
(R):5'- AGCAACTGATGTTTCTGTCTCAC -3'

Sequencing Primer
(F):5'- AAACGTCCTGGTGTTTTTGTGCC -3'
(R):5'- CTGTCTCACATGGTTGATTATGTTC -3'
Posted On2015-10-08