Incidental Mutation 'R4649:Csmd2'
ID350573
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 041910-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock #R4649 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128546073 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 3107 (V3107M)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139561
Predicted Effect probably benign
Transcript: ENSMUST00000184063
AA Change: V3107M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,169,893 V841F probably damaging Het
Adcy10 G A 1: 165,504,049 E84K probably damaging Het
Adgrg6 C A 10: 14,468,827 M127I probably damaging Het
Agpat5 A G 8: 18,879,652 I266V possibly damaging Het
Agtpbp1 A T 13: 59,528,399 Y186N possibly damaging Het
Alx1 A T 10: 103,009,332 N279K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Arsi A G 18: 60,917,098 Y351C probably damaging Het
B4galnt3 T A 6: 120,224,620 R155W probably damaging Het
BC028528 T C 3: 95,888,265 E75G probably damaging Het
Bmp2k C T 5: 97,053,111 P297S possibly damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Bzw2 A T 12: 36,123,981 V98E probably null Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Cd19 A G 7: 126,414,492 S42P probably benign Het
Chml A G 1: 175,687,396 S138P probably benign Het
Clic6 T G 16: 92,530,939 probably null Het
Col12a1 A T 9: 79,639,794 V2252E probably damaging Het
Cplx2 G A 13: 54,379,548 E82K probably benign Het
Cspg4 T A 9: 56,886,865 V628D possibly damaging Het
Dcaf13 G A 15: 39,138,242 R315Q possibly damaging Het
Deaf1 A G 7: 141,297,573 V547A possibly damaging Het
Dmxl1 C T 18: 49,878,631 T1285I probably damaging Het
Dnah3 C A 7: 120,047,698 W1036L probably damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dsg2 T A 18: 20,602,245 D1093E possibly damaging Het
Edaradd T A 13: 12,508,423 H12L probably damaging Het
Enam T C 5: 88,492,968 M163T probably benign Het
Fbxo22 T A 9: 55,221,049 V218E probably damaging Het
Fbxo34 A T 14: 47,529,628 K148N probably damaging Het
Foxi3 A G 6: 70,956,976 D149G probably damaging Het
Gbp8 C T 5: 105,041,941 G75D probably damaging Het
Gm10784 C T 13: 49,945,215 noncoding transcript Het
Gm11127 T C 17: 36,057,876 Y104C possibly damaging Het
Gm7247 G A 14: 51,569,594 probably null Het
Grik3 T A 4: 125,650,485 V333E probably damaging Het
Gsap A T 5: 21,226,311 D211V probably damaging Het
Ino80 T C 2: 119,431,008 N725S probably damaging Het
Itgad A G 7: 128,189,531 I443V probably benign Het
Itsn1 T A 16: 91,841,588 I52N probably damaging Het
Kmt2b TCTCCTCCTCCTCCTCCTCCTCCTCC TCTCCTCCTCCTCCTCCTCCTCC 7: 30,586,358 probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Lyn C A 4: 3,738,850 Q41K probably benign Het
Mapk13 C T 17: 28,778,487 R360* probably null Het
Mapk8ip3 T A 17: 24,904,752 I599F probably damaging Het
Me1 T C 9: 86,679,852 K60R probably benign Het
Mga T A 2: 119,941,493 D1532E possibly damaging Het
Miga1 G A 3: 152,279,005 S427L probably benign Het
Mknk2 A T 10: 80,669,339 V186E probably damaging Het
Myo1a C A 10: 127,710,217 N236K probably benign Het
Myt1 A G 2: 181,797,414 D243G probably benign Het
Ncf4 T C 15: 78,255,989 V196A possibly damaging Het
Nlrp5 G T 7: 23,418,178 L442F probably damaging Het
Olfm4 G A 14: 80,021,307 D332N probably benign Het
Olfr1254 C A 2: 89,789,293 V20F probably benign Het
Olfr32 T A 2: 90,139,088 D17V probably damaging Het
Osbpl11 T A 16: 33,196,082 M69K probably benign Het
Oxnad1 T A 14: 32,102,409 *312K probably null Het
Plekhg1 A G 10: 3,956,985 Q634R probably benign Het
Plekhh2 T C 17: 84,575,263 Y733H probably damaging Het
Ppp1r21 A G 17: 88,549,513 H132R probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pudp T C 18: 50,568,188 D158G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Ranbp3 T A 17: 56,696,640 probably null Het
Ranbp6 A G 19: 29,810,321 V877A probably benign Het
Rgsl1 A T 1: 153,817,582 S618T probably benign Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rhox2a A T X: 37,245,362 I61L probably benign Het
Rnf207 A C 4: 152,312,155 D466E probably benign Het
Rnf7 A G 9: 96,471,830 I80T probably benign Het
Ros1 T A 10: 52,129,668 I878F possibly damaging Het
Rsbn1 T A 3: 103,953,780 probably null Het
Sbk1 T C 7: 126,291,129 S105P probably damaging Het
Sdk1 T C 5: 142,006,625 Y790H probably damaging Het
Sec62 T A 3: 30,810,534 N182K unknown Het
Slc15a1 T C 14: 121,478,092 Y345C probably damaging Het
Slc27a1 G A 8: 71,570,764 A15T probably benign Het
Slc35d1 A G 4: 103,213,229 F110L probably damaging Het
Slc39a5 T A 10: 128,397,267 S333C probably benign Het
Tarbp1 A G 8: 126,447,195 S927P probably damaging Het
Tns1 A G 1: 73,953,771 S583P probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trim40 T C 17: 36,882,639 probably null Het
Trim42 C A 9: 97,362,945 V601L probably benign Het
Trpc7 G A 13: 56,887,554 R189C probably damaging Het
Ttc29 A T 8: 78,333,579 Y376F probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vmn2r68 C A 7: 85,221,535 A847S probably benign Het
Wdr63 A G 3: 146,048,167 S713P probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Zfat A G 15: 68,184,476 Y237H probably damaging Het
Zfp236 A T 18: 82,597,659 W1840R probably damaging Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp462 T A 4: 55,009,349 N438K probably benign Het
Zfp952 T A 17: 33,002,925 V88E probably damaging Het
Znfx1 G T 2: 167,056,356 A216D probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
Predicted Primers PCR Primer
(F):5'- TAGATGGCATGCATGGTATAGGC -3'
(R):5'- CTTAACCATGCGCACTCCTG -3'

Sequencing Primer
(F):5'- TATAGGCATGAACAGTGGACC -3'
(R):5'- ACTCCTGCTGGGATGCCAAC -3'
Posted On2015-10-08