Incidental Mutation 'R4649:Enam'
ID350578
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Nameenamelin
Synonymsabte
MMRRC Submission 041910-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R4649 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location88487975-88506049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88492968 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 163 (M163T)
Ref Sequence ENSEMBL: ENSMUSP00000142854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
Predicted Effect probably benign
Transcript: ENSMUST00000031222
AA Change: M88T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: M88T

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199104
AA Change: M163T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: M163T

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,169,893 V841F probably damaging Het
Adcy10 G A 1: 165,504,049 E84K probably damaging Het
Adgrg6 C A 10: 14,468,827 M127I probably damaging Het
Agpat5 A G 8: 18,879,652 I266V possibly damaging Het
Agtpbp1 A T 13: 59,528,399 Y186N possibly damaging Het
Alx1 A T 10: 103,009,332 N279K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Arsi A G 18: 60,917,098 Y351C probably damaging Het
B4galnt3 T A 6: 120,224,620 R155W probably damaging Het
BC028528 T C 3: 95,888,265 E75G probably damaging Het
Bmp2k C T 5: 97,053,111 P297S possibly damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Bzw2 A T 12: 36,123,981 V98E probably null Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Cd19 A G 7: 126,414,492 S42P probably benign Het
Chml A G 1: 175,687,396 S138P probably benign Het
Clic6 T G 16: 92,530,939 probably null Het
Col12a1 A T 9: 79,639,794 V2252E probably damaging Het
Cplx2 G A 13: 54,379,548 E82K probably benign Het
Csmd2 G A 4: 128,546,073 V3107M probably benign Het
Cspg4 T A 9: 56,886,865 V628D possibly damaging Het
Dcaf13 G A 15: 39,138,242 R315Q possibly damaging Het
Deaf1 A G 7: 141,297,573 V547A possibly damaging Het
Dmxl1 C T 18: 49,878,631 T1285I probably damaging Het
Dnah3 C A 7: 120,047,698 W1036L probably damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dsg2 T A 18: 20,602,245 D1093E possibly damaging Het
Edaradd T A 13: 12,508,423 H12L probably damaging Het
Fbxo22 T A 9: 55,221,049 V218E probably damaging Het
Fbxo34 A T 14: 47,529,628 K148N probably damaging Het
Foxi3 A G 6: 70,956,976 D149G probably damaging Het
Gbp8 C T 5: 105,041,941 G75D probably damaging Het
Gm10784 C T 13: 49,945,215 noncoding transcript Het
Gm11127 T C 17: 36,057,876 Y104C possibly damaging Het
Gm7247 G A 14: 51,569,594 probably null Het
Grik3 T A 4: 125,650,485 V333E probably damaging Het
Gsap A T 5: 21,226,311 D211V probably damaging Het
Ino80 T C 2: 119,431,008 N725S probably damaging Het
Itgad A G 7: 128,189,531 I443V probably benign Het
Itsn1 T A 16: 91,841,588 I52N probably damaging Het
Kmt2b TCTCCTCCTCCTCCTCCTCCTCCTCC TCTCCTCCTCCTCCTCCTCCTCC 7: 30,586,358 probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Lyn C A 4: 3,738,850 Q41K probably benign Het
Mapk13 C T 17: 28,778,487 R360* probably null Het
Mapk8ip3 T A 17: 24,904,752 I599F probably damaging Het
Me1 T C 9: 86,679,852 K60R probably benign Het
Mga T A 2: 119,941,493 D1532E possibly damaging Het
Miga1 G A 3: 152,279,005 S427L probably benign Het
Mknk2 A T 10: 80,669,339 V186E probably damaging Het
Myo1a C A 10: 127,710,217 N236K probably benign Het
Myt1 A G 2: 181,797,414 D243G probably benign Het
Ncf4 T C 15: 78,255,989 V196A possibly damaging Het
Nlrp5 G T 7: 23,418,178 L442F probably damaging Het
Olfm4 G A 14: 80,021,307 D332N probably benign Het
Olfr1254 C A 2: 89,789,293 V20F probably benign Het
Olfr32 T A 2: 90,139,088 D17V probably damaging Het
Osbpl11 T A 16: 33,196,082 M69K probably benign Het
Oxnad1 T A 14: 32,102,409 *312K probably null Het
Plekhg1 A G 10: 3,956,985 Q634R probably benign Het
Plekhh2 T C 17: 84,575,263 Y733H probably damaging Het
Ppp1r21 A G 17: 88,549,513 H132R probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pudp T C 18: 50,568,188 D158G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Ranbp3 T A 17: 56,696,640 probably null Het
Ranbp6 A G 19: 29,810,321 V877A probably benign Het
Rgsl1 A T 1: 153,817,582 S618T probably benign Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rhox2a A T X: 37,245,362 I61L probably benign Het
Rnf207 A C 4: 152,312,155 D466E probably benign Het
Rnf7 A G 9: 96,471,830 I80T probably benign Het
Ros1 T A 10: 52,129,668 I878F possibly damaging Het
Rsbn1 T A 3: 103,953,780 probably null Het
Sbk1 T C 7: 126,291,129 S105P probably damaging Het
Sdk1 T C 5: 142,006,625 Y790H probably damaging Het
Sec62 T A 3: 30,810,534 N182K unknown Het
Slc15a1 T C 14: 121,478,092 Y345C probably damaging Het
Slc27a1 G A 8: 71,570,764 A15T probably benign Het
Slc35d1 A G 4: 103,213,229 F110L probably damaging Het
Slc39a5 T A 10: 128,397,267 S333C probably benign Het
Tarbp1 A G 8: 126,447,195 S927P probably damaging Het
Tns1 A G 1: 73,953,771 S583P probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trim40 T C 17: 36,882,639 probably null Het
Trim42 C A 9: 97,362,945 V601L probably benign Het
Trpc7 G A 13: 56,887,554 R189C probably damaging Het
Ttc29 A T 8: 78,333,579 Y376F probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vmn2r68 C A 7: 85,221,535 A847S probably benign Het
Wdr63 A G 3: 146,048,167 S713P probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Zfat A G 15: 68,184,476 Y237H probably damaging Het
Zfp236 A T 18: 82,597,659 W1840R probably damaging Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp462 T A 4: 55,009,349 N438K probably benign Het
Zfp952 T A 17: 33,002,925 V88E probably damaging Het
Znfx1 G T 2: 167,056,356 A216D probably benign Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88501484 missense possibly damaging 0.83
IGL01611:Enam APN 5 88503749 missense probably damaging 0.99
IGL01802:Enam APN 5 88503674 missense possibly damaging 0.93
IGL02220:Enam APN 5 88504559 nonsense probably null
IGL02371:Enam APN 5 88502809 missense probably benign 0.39
IGL02596:Enam APN 5 88503026 missense probably benign 0.01
IGL03026:Enam APN 5 88503299 missense probably benign 0.38
IGL03303:Enam APN 5 88504591 missense probably benign 0.12
opinionated UTSW 5 88503026 missense probably benign 0.04
recalcitrant UTSW 5 88503791 nonsense probably null
R0200:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0230:Enam UTSW 5 88489655 splice site probably benign
R0395:Enam UTSW 5 88501508 missense probably damaging 0.99
R0548:Enam UTSW 5 88503105 missense probably damaging 0.96
R0608:Enam UTSW 5 88493027 missense possibly damaging 0.96
R0724:Enam UTSW 5 88501994 missense probably damaging 1.00
R0927:Enam UTSW 5 88494060 missense possibly damaging 0.72
R1023:Enam UTSW 5 88501967 missense probably damaging 0.99
R1053:Enam UTSW 5 88504019 missense possibly damaging 0.64
R1169:Enam UTSW 5 88503258 missense probably damaging 1.00
R1230:Enam UTSW 5 88494068 missense probably damaging 0.99
R1324:Enam UTSW 5 88494068 missense possibly damaging 0.53
R1663:Enam UTSW 5 88503994 missense probably damaging 1.00
R1727:Enam UTSW 5 88503994 missense probably damaging 1.00
R1750:Enam UTSW 5 88503227 missense probably damaging 1.00
R1852:Enam UTSW 5 88504465 missense possibly damaging 0.92
R1907:Enam UTSW 5 88504622 missense possibly damaging 0.86
R2104:Enam UTSW 5 88501787 missense probably damaging 1.00
R2143:Enam UTSW 5 88492920 missense probably benign 0.02
R2196:Enam UTSW 5 88502744 missense probably damaging 0.99
R2363:Enam UTSW 5 88503149 missense probably benign 0.24
R2497:Enam UTSW 5 88502694 missense probably benign 0.13
R3615:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3616:Enam UTSW 5 88504447 missense possibly damaging 0.81
R3782:Enam UTSW 5 88502815 missense probably damaging 1.00
R4067:Enam UTSW 5 88503377 missense probably damaging 1.00
R4349:Enam UTSW 5 88503548 missense probably damaging 0.99
R4604:Enam UTSW 5 88504283 missense possibly damaging 0.93
R4702:Enam UTSW 5 88503791 nonsense probably null
R4703:Enam UTSW 5 88503791 nonsense probably null
R4704:Enam UTSW 5 88503791 nonsense probably null
R4705:Enam UTSW 5 88503791 nonsense probably null
R4714:Enam UTSW 5 88503536 missense probably damaging 1.00
R4748:Enam UTSW 5 88501543 missense probably damaging 1.00
R4838:Enam UTSW 5 88493108 nonsense probably null
R4840:Enam UTSW 5 88503026 missense probably benign 0.04
R4856:Enam UTSW 5 88488734 nonsense probably null
R4886:Enam UTSW 5 88488734 nonsense probably null
R4910:Enam UTSW 5 88502314 missense probably benign
R4911:Enam UTSW 5 88502314 missense probably benign
R6103:Enam UTSW 5 88502328 missense probably damaging 0.96
R6651:Enam UTSW 5 88502917 missense probably damaging 0.98
R6759:Enam UTSW 5 88501691 missense probably damaging 1.00
R7282:Enam UTSW 5 88502327 missense probably damaging 0.99
R7365:Enam UTSW 5 88501488 missense possibly damaging 0.75
R7392:Enam UTSW 5 88501664 missense probably damaging 0.99
X0018:Enam UTSW 5 88502691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCCTTTGATTCGTTTGACAG -3'
(R):5'- GTGGTTCCTTTAAAGGCTGC -3'

Sequencing Primer
(F):5'- CAGGCTTTCTAGAAAACTGAGGTCTC -3'
(R):5'- CCTTTAAAGGCTGCTTTTGTGGC -3'
Posted On2015-10-08