Incidental Mutation 'R4649:Vmn2r63'
ID350587
Institutional Source Beutler Lab
Gene Symbol Vmn2r63
Ensembl Gene ENSMUSG00000090751
Gene Namevomeronasal 2, receptor 63
SynonymsEG435975
MMRRC Submission 041910-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4649 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42903251-42933789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42903690 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 714 (I714T)
Ref Sequence ENSEMBL: ENSMUSP00000129089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163803]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163803
AA Change: I714T

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129089
Gene: ENSMUSG00000090751
AA Change: I714T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 3.5e-43 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 3.5e-51 PFAM
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,169,893 V841F probably damaging Het
Adcy10 G A 1: 165,504,049 E84K probably damaging Het
Adgrg6 C A 10: 14,468,827 M127I probably damaging Het
Agpat5 A G 8: 18,879,652 I266V possibly damaging Het
Agtpbp1 A T 13: 59,528,399 Y186N possibly damaging Het
Alx1 A T 10: 103,009,332 N279K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Arsi A G 18: 60,917,098 Y351C probably damaging Het
B4galnt3 T A 6: 120,224,620 R155W probably damaging Het
BC028528 T C 3: 95,888,265 E75G probably damaging Het
Bmp2k C T 5: 97,053,111 P297S possibly damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Bzw2 A T 12: 36,123,981 V98E probably null Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Cd19 A G 7: 126,414,492 S42P probably benign Het
Chml A G 1: 175,687,396 S138P probably benign Het
Clic6 T G 16: 92,530,939 probably null Het
Col12a1 A T 9: 79,639,794 V2252E probably damaging Het
Cplx2 G A 13: 54,379,548 E82K probably benign Het
Csmd2 G A 4: 128,546,073 V3107M probably benign Het
Cspg4 T A 9: 56,886,865 V628D possibly damaging Het
Dcaf13 G A 15: 39,138,242 R315Q possibly damaging Het
Deaf1 A G 7: 141,297,573 V547A possibly damaging Het
Dmxl1 C T 18: 49,878,631 T1285I probably damaging Het
Dnah3 C A 7: 120,047,698 W1036L probably damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dsg2 T A 18: 20,602,245 D1093E possibly damaging Het
Edaradd T A 13: 12,508,423 H12L probably damaging Het
Enam T C 5: 88,492,968 M163T probably benign Het
Fbxo22 T A 9: 55,221,049 V218E probably damaging Het
Fbxo34 A T 14: 47,529,628 K148N probably damaging Het
Foxi3 A G 6: 70,956,976 D149G probably damaging Het
Gbp8 C T 5: 105,041,941 G75D probably damaging Het
Gm10784 C T 13: 49,945,215 noncoding transcript Het
Gm11127 T C 17: 36,057,876 Y104C possibly damaging Het
Gm7247 G A 14: 51,569,594 probably null Het
Grik3 T A 4: 125,650,485 V333E probably damaging Het
Gsap A T 5: 21,226,311 D211V probably damaging Het
Ino80 T C 2: 119,431,008 N725S probably damaging Het
Itgad A G 7: 128,189,531 I443V probably benign Het
Itsn1 T A 16: 91,841,588 I52N probably damaging Het
Kmt2b TCTCCTCCTCCTCCTCCTCCTCCTCC TCTCCTCCTCCTCCTCCTCCTCC 7: 30,586,358 probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Lyn C A 4: 3,738,850 Q41K probably benign Het
Mapk13 C T 17: 28,778,487 R360* probably null Het
Mapk8ip3 T A 17: 24,904,752 I599F probably damaging Het
Me1 T C 9: 86,679,852 K60R probably benign Het
Mga T A 2: 119,941,493 D1532E possibly damaging Het
Miga1 G A 3: 152,279,005 S427L probably benign Het
Mknk2 A T 10: 80,669,339 V186E probably damaging Het
Myo1a C A 10: 127,710,217 N236K probably benign Het
Myt1 A G 2: 181,797,414 D243G probably benign Het
Ncf4 T C 15: 78,255,989 V196A possibly damaging Het
Nlrp5 G T 7: 23,418,178 L442F probably damaging Het
Olfm4 G A 14: 80,021,307 D332N probably benign Het
Olfr1254 C A 2: 89,789,293 V20F probably benign Het
Olfr32 T A 2: 90,139,088 D17V probably damaging Het
Osbpl11 T A 16: 33,196,082 M69K probably benign Het
Oxnad1 T A 14: 32,102,409 *312K probably null Het
Plekhg1 A G 10: 3,956,985 Q634R probably benign Het
Plekhh2 T C 17: 84,575,263 Y733H probably damaging Het
Ppp1r21 A G 17: 88,549,513 H132R probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pudp T C 18: 50,568,188 D158G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Ranbp3 T A 17: 56,696,640 probably null Het
Ranbp6 A G 19: 29,810,321 V877A probably benign Het
Rgsl1 A T 1: 153,817,582 S618T probably benign Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rhox2a A T X: 37,245,362 I61L probably benign Het
Rnf207 A C 4: 152,312,155 D466E probably benign Het
Rnf7 A G 9: 96,471,830 I80T probably benign Het
Ros1 T A 10: 52,129,668 I878F possibly damaging Het
Rsbn1 T A 3: 103,953,780 probably null Het
Sbk1 T C 7: 126,291,129 S105P probably damaging Het
Sdk1 T C 5: 142,006,625 Y790H probably damaging Het
Sec62 T A 3: 30,810,534 N182K unknown Het
Slc15a1 T C 14: 121,478,092 Y345C probably damaging Het
Slc27a1 G A 8: 71,570,764 A15T probably benign Het
Slc35d1 A G 4: 103,213,229 F110L probably damaging Het
Slc39a5 T A 10: 128,397,267 S333C probably benign Het
Tarbp1 A G 8: 126,447,195 S927P probably damaging Het
Tns1 A G 1: 73,953,771 S583P probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trim40 T C 17: 36,882,639 probably null Het
Trim42 C A 9: 97,362,945 V601L probably benign Het
Trpc7 G A 13: 56,887,554 R189C probably damaging Het
Ttc29 A T 8: 78,333,579 Y376F probably benign Het
Vmn2r68 C A 7: 85,221,535 A847S probably benign Het
Wdr63 A G 3: 146,048,167 S713P probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Zfat A G 15: 68,184,476 Y237H probably damaging Het
Zfp236 A T 18: 82,597,659 W1840R probably damaging Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp462 T A 4: 55,009,349 N438K probably benign Het
Zfp952 T A 17: 33,002,925 V88E probably damaging Het
Znfx1 G T 2: 167,056,356 A216D probably benign Het
Other mutations in Vmn2r63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Vmn2r63 APN 7 42904119 missense probably damaging 0.99
IGL01765:Vmn2r63 APN 7 42903364 missense probably benign
IGL02203:Vmn2r63 APN 7 42904008 missense probably benign 0.01
IGL02825:Vmn2r63 APN 7 42926850 critical splice donor site probably null
IGL03155:Vmn2r63 APN 7 42903454 missense probably damaging 1.00
IGL03260:Vmn2r63 APN 7 42929192 missense probably damaging 1.00
IGL03411:Vmn2r63 APN 7 42927944 missense probably benign 0.42
PIT4280001:Vmn2r63 UTSW 7 42903985 missense probably damaging 1.00
R0066:Vmn2r63 UTSW 7 42927090 splice site probably benign
R0328:Vmn2r63 UTSW 7 42903275 missense probably benign 0.09
R0344:Vmn2r63 UTSW 7 42903618 missense probably damaging 0.98
R0554:Vmn2r63 UTSW 7 42933705 nonsense probably null
R0555:Vmn2r63 UTSW 7 42928528 nonsense probably null
R0685:Vmn2r63 UTSW 7 42928010 missense probably benign 0.13
R0751:Vmn2r63 UTSW 7 42928035 missense probably damaging 1.00
R1349:Vmn2r63 UTSW 7 42929218 missense possibly damaging 0.95
R1372:Vmn2r63 UTSW 7 42929218 missense possibly damaging 0.95
R1416:Vmn2r63 UTSW 7 42927915 missense probably benign 0.00
R1502:Vmn2r63 UTSW 7 42928591 missense possibly damaging 0.62
R1563:Vmn2r63 UTSW 7 42904126 missense probably benign 0.00
R1652:Vmn2r63 UTSW 7 42928211 missense probably benign 0.32
R1693:Vmn2r63 UTSW 7 42928319 missense probably benign
R1698:Vmn2r63 UTSW 7 42933614 missense probably benign
R1753:Vmn2r63 UTSW 7 42928245 nonsense probably null
R2136:Vmn2r63 UTSW 7 42926873 missense probably damaging 0.99
R2175:Vmn2r63 UTSW 7 42933580 critical splice donor site probably null
R2261:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R2262:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R2263:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R3413:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3426:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3427:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3802:Vmn2r63 UTSW 7 42903405 missense probably damaging 0.99
R4319:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4321:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4323:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4346:Vmn2r63 UTSW 7 42928113 missense possibly damaging 0.67
R4568:Vmn2r63 UTSW 7 42933826 unclassified probably null
R4653:Vmn2r63 UTSW 7 42903690 missense possibly damaging 0.79
R4679:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4734:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4741:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4748:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4806:Vmn2r63 UTSW 7 42926890 missense probably benign 0.34
R4933:Vmn2r63 UTSW 7 42903978 missense probably damaging 1.00
R5198:Vmn2r63 UTSW 7 42903745 missense probably benign 0.01
R5399:Vmn2r63 UTSW 7 42928277 missense probably benign
R5400:Vmn2r63 UTSW 7 42928211 missense probably benign 0.32
R6158:Vmn2r63 UTSW 7 42933680 missense probably damaging 1.00
R6185:Vmn2r63 UTSW 7 42929011 missense probably damaging 0.98
R6267:Vmn2r63 UTSW 7 42928635 intron probably null
R6362:Vmn2r63 UTSW 7 42903297 missense probably benign
R6706:Vmn2r63 UTSW 7 42928577 missense probably damaging 1.00
R6764:Vmn2r63 UTSW 7 42903271 missense probably damaging 0.97
R7104:Vmn2r63 UTSW 7 42928535 missense possibly damaging 0.67
Z1088:Vmn2r63 UTSW 7 42928559 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGATTCCTGGATAAGAAGGCC -3'
(R):5'- TGCTTGCTCTACATTGGGCAG -3'

Sequencing Primer
(F):5'- CATGGTATAGCTCCCAAGTGCTAAG -3'
(R):5'- CATCTTGCAGCAAACAGCATTTGG -3'
Posted On2015-10-08