Incidental Mutation 'R4649:Mknk2'
ID350612
Institutional Source Beutler Lab
Gene Symbol Mknk2
Ensembl Gene ENSMUSG00000020190
Gene NameMAP kinase-interacting serine/threonine kinase 2
SynonymsMnk2
MMRRC Submission 041910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4649 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80665327-80678112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80669339 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 186 (V186E)
Ref Sequence ENSEMBL: ENSMUSP00000143508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003433] [ENSMUST00000197276] [ENSMUST00000198819] [ENSMUST00000199949] [ENSMUST00000200082]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003433
AA Change: V139E

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003433
Gene: ENSMUSG00000020190
AA Change: V139E

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
S_TKc 36 321 7.09e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197276
SMART Domains Protein: ENSMUSP00000143679
Gene: ENSMUSG00000020190

DomainStartEndE-ValueType
SCOP:d1koba_ 52 118 3e-11 SMART
PDB:2AC3|A 59 118 3e-32 PDB
Blast:S_TKc 71 118 1e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198819
Predicted Effect probably benign
Transcript: ENSMUST00000199949
Predicted Effect probably damaging
Transcript: ENSMUST00000200082
AA Change: V186E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143508
Gene: ENSMUSG00000020190
AA Change: V186E

DomainStartEndE-ValueType
low complexity region 60 70 N/A INTRINSIC
S_TKc 83 368 7.09e-88 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine-protein kinase, which is targeted by both the extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways. This enzyme targets several substrates including eukaryotic translation initiation factor 4E and mammalian target of rapamycin, which are negatively regulated by its phosphorylation. Null mutant mice do not exhibit developmental or reproductive defects. However, mice null for both this protein and mitogen-activated protein kinase-interacting serine/threonine protein kinase 1 have delayed tumor development in phosphatase and tensin homolog mutant mice, indicating an oncogenic function for this gene in tumor development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,169,893 V841F probably damaging Het
Adcy10 G A 1: 165,504,049 E84K probably damaging Het
Adgrg6 C A 10: 14,468,827 M127I probably damaging Het
Agpat5 A G 8: 18,879,652 I266V possibly damaging Het
Agtpbp1 A T 13: 59,528,399 Y186N possibly damaging Het
Alx1 A T 10: 103,009,332 N279K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Arsi A G 18: 60,917,098 Y351C probably damaging Het
B4galnt3 T A 6: 120,224,620 R155W probably damaging Het
BC028528 T C 3: 95,888,265 E75G probably damaging Het
Bmp2k C T 5: 97,053,111 P297S possibly damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Bzw2 A T 12: 36,123,981 V98E probably null Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Cd19 A G 7: 126,414,492 S42P probably benign Het
Chml A G 1: 175,687,396 S138P probably benign Het
Clic6 T G 16: 92,530,939 probably null Het
Col12a1 A T 9: 79,639,794 V2252E probably damaging Het
Cplx2 G A 13: 54,379,548 E82K probably benign Het
Csmd2 G A 4: 128,546,073 V3107M probably benign Het
Cspg4 T A 9: 56,886,865 V628D possibly damaging Het
Dcaf13 G A 15: 39,138,242 R315Q possibly damaging Het
Deaf1 A G 7: 141,297,573 V547A possibly damaging Het
Dmxl1 C T 18: 49,878,631 T1285I probably damaging Het
Dnah3 C A 7: 120,047,698 W1036L probably damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dsg2 T A 18: 20,602,245 D1093E possibly damaging Het
Edaradd T A 13: 12,508,423 H12L probably damaging Het
Enam T C 5: 88,492,968 M163T probably benign Het
Fbxo22 T A 9: 55,221,049 V218E probably damaging Het
Fbxo34 A T 14: 47,529,628 K148N probably damaging Het
Foxi3 A G 6: 70,956,976 D149G probably damaging Het
Gbp8 C T 5: 105,041,941 G75D probably damaging Het
Gm10784 C T 13: 49,945,215 noncoding transcript Het
Gm11127 T C 17: 36,057,876 Y104C possibly damaging Het
Gm7247 G A 14: 51,569,594 probably null Het
Grik3 T A 4: 125,650,485 V333E probably damaging Het
Gsap A T 5: 21,226,311 D211V probably damaging Het
Ino80 T C 2: 119,431,008 N725S probably damaging Het
Itgad A G 7: 128,189,531 I443V probably benign Het
Itsn1 T A 16: 91,841,588 I52N probably damaging Het
Kmt2b TCTCCTCCTCCTCCTCCTCCTCCTCC TCTCCTCCTCCTCCTCCTCCTCC 7: 30,586,358 probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Lyn C A 4: 3,738,850 Q41K probably benign Het
Mapk13 C T 17: 28,778,487 R360* probably null Het
Mapk8ip3 T A 17: 24,904,752 I599F probably damaging Het
Me1 T C 9: 86,679,852 K60R probably benign Het
Mga T A 2: 119,941,493 D1532E possibly damaging Het
Miga1 G A 3: 152,279,005 S427L probably benign Het
Myo1a C A 10: 127,710,217 N236K probably benign Het
Myt1 A G 2: 181,797,414 D243G probably benign Het
Ncf4 T C 15: 78,255,989 V196A possibly damaging Het
Nlrp5 G T 7: 23,418,178 L442F probably damaging Het
Olfm4 G A 14: 80,021,307 D332N probably benign Het
Olfr1254 C A 2: 89,789,293 V20F probably benign Het
Olfr32 T A 2: 90,139,088 D17V probably damaging Het
Osbpl11 T A 16: 33,196,082 M69K probably benign Het
Oxnad1 T A 14: 32,102,409 *312K probably null Het
Plekhg1 A G 10: 3,956,985 Q634R probably benign Het
Plekhh2 T C 17: 84,575,263 Y733H probably damaging Het
Ppp1r21 A G 17: 88,549,513 H132R probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pudp T C 18: 50,568,188 D158G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Ranbp3 T A 17: 56,696,640 probably null Het
Ranbp6 A G 19: 29,810,321 V877A probably benign Het
Rgsl1 A T 1: 153,817,582 S618T probably benign Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rhox2a A T X: 37,245,362 I61L probably benign Het
Rnf207 A C 4: 152,312,155 D466E probably benign Het
Rnf7 A G 9: 96,471,830 I80T probably benign Het
Ros1 T A 10: 52,129,668 I878F possibly damaging Het
Rsbn1 T A 3: 103,953,780 probably null Het
Sbk1 T C 7: 126,291,129 S105P probably damaging Het
Sdk1 T C 5: 142,006,625 Y790H probably damaging Het
Sec62 T A 3: 30,810,534 N182K unknown Het
Slc15a1 T C 14: 121,478,092 Y345C probably damaging Het
Slc27a1 G A 8: 71,570,764 A15T probably benign Het
Slc35d1 A G 4: 103,213,229 F110L probably damaging Het
Slc39a5 T A 10: 128,397,267 S333C probably benign Het
Tarbp1 A G 8: 126,447,195 S927P probably damaging Het
Tns1 A G 1: 73,953,771 S583P probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trim40 T C 17: 36,882,639 probably null Het
Trim42 C A 9: 97,362,945 V601L probably benign Het
Trpc7 G A 13: 56,887,554 R189C probably damaging Het
Ttc29 A T 8: 78,333,579 Y376F probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vmn2r68 C A 7: 85,221,535 A847S probably benign Het
Wdr63 A G 3: 146,048,167 S713P probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Zfat A G 15: 68,184,476 Y237H probably damaging Het
Zfp236 A T 18: 82,597,659 W1840R probably damaging Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp462 T A 4: 55,009,349 N438K probably benign Het
Zfp952 T A 17: 33,002,925 V88E probably damaging Het
Znfx1 G T 2: 167,056,356 A216D probably benign Het
Other mutations in Mknk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Mknk2 APN 10 80667664 splice site probably benign
IGL02471:Mknk2 APN 10 80668121 missense probably damaging 0.99
IGL02643:Mknk2 APN 10 80668601 missense probably damaging 1.00
H8562:Mknk2 UTSW 10 80668934 splice site probably benign
IGL03052:Mknk2 UTSW 10 80669662 missense probably benign 0.12
R0645:Mknk2 UTSW 10 80671908 unclassified probably null
R2061:Mknk2 UTSW 10 80671557 critical splice donor site probably null
R2105:Mknk2 UTSW 10 80668601 missense possibly damaging 0.90
R2167:Mknk2 UTSW 10 80668701 missense probably damaging 1.00
R3847:Mknk2 UTSW 10 80667975 nonsense probably null
R5062:Mknk2 UTSW 10 80671769 missense probably damaging 1.00
R5358:Mknk2 UTSW 10 80671763 missense probably benign 0.19
R5433:Mknk2 UTSW 10 80667225 missense probably benign 0.00
R5518:Mknk2 UTSW 10 80668641 missense possibly damaging 0.92
R5813:Mknk2 UTSW 10 80675862 missense probably benign 0.34
R6060:Mknk2 UTSW 10 80671634 missense probably benign 0.00
R6151:Mknk2 UTSW 10 80669025 unclassified probably null
R6366:Mknk2 UTSW 10 80671933 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCACATAGGATGTTCTCTGGC -3'
(R):5'- ACAGGAAGTGCCATCCAAGG -3'

Sequencing Primer
(F):5'- CACATAGGATGTTCTCTGGCTTTAG -3'
(R):5'- AAGGGCCCCAGCTTTGATG -3'
Posted On2015-10-08