Incidental Mutation 'R4649:Agtpbp1'
ID350626
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene NameATP/GTP binding protein 1
Synonyms2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik
MMRRC Submission 041910-MU
Accession Numbers

Genbank: NM_023328; MGI: 2159437

Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R4649 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59445742-59585227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59528399 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 186 (Y186N)
Ref Sequence ENSEMBL: ENSMUSP00000132854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000109830] [ENSMUST00000164215] [ENSMUST00000165370] [ENSMUST00000165477] [ENSMUST00000165598] [ENSMUST00000165851] [ENSMUST00000166585] [ENSMUST00000167096] [ENSMUST00000167593] [ENSMUST00000168821] [ENSMUST00000169745] [ENSMUST00000170378] [ENSMUST00000170520] [ENSMUST00000170555] [ENSMUST00000171606]
Predicted Effect probably benign
Transcript: ENSMUST00000022040
AA Change: Y186N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: Y186N

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109830
AA Change: Y186N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: Y186N

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163149
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164215
AA Change: Y186N

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: Y186N

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000165370
AA Change: Y137N
Predicted Effect possibly damaging
Transcript: ENSMUST00000165477
AA Change: Y186N

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000165598
Predicted Effect probably benign
Transcript: ENSMUST00000165851
Predicted Effect probably benign
Transcript: ENSMUST00000166585
Predicted Effect probably benign
Transcript: ENSMUST00000167096
Predicted Effect probably benign
Transcript: ENSMUST00000167593
Predicted Effect probably benign
Transcript: ENSMUST00000168821
Predicted Effect possibly damaging
Transcript: ENSMUST00000169745
AA Change: Y186N

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000170378
Predicted Effect probably benign
Transcript: ENSMUST00000170520
Predicted Effect probably benign
Transcript: ENSMUST00000170555
AA Change: Y186N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: Y186N

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171606
AA Change: Y186N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: Y186N

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,169,893 V841F probably damaging Het
Adcy10 G A 1: 165,504,049 E84K probably damaging Het
Adgrg6 C A 10: 14,468,827 M127I probably damaging Het
Agpat5 A G 8: 18,879,652 I266V possibly damaging Het
Alx1 A T 10: 103,009,332 N279K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Arsi A G 18: 60,917,098 Y351C probably damaging Het
B4galnt3 T A 6: 120,224,620 R155W probably damaging Het
BC028528 T C 3: 95,888,265 E75G probably damaging Het
Bmp2k C T 5: 97,053,111 P297S possibly damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Bzw2 A T 12: 36,123,981 V98E probably null Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Cd19 A G 7: 126,414,492 S42P probably benign Het
Chml A G 1: 175,687,396 S138P probably benign Het
Clic6 T G 16: 92,530,939 probably null Het
Col12a1 A T 9: 79,639,794 V2252E probably damaging Het
Cplx2 G A 13: 54,379,548 E82K probably benign Het
Csmd2 G A 4: 128,546,073 V3107M probably benign Het
Cspg4 T A 9: 56,886,865 V628D possibly damaging Het
Dcaf13 G A 15: 39,138,242 R315Q possibly damaging Het
Deaf1 A G 7: 141,297,573 V547A possibly damaging Het
Dmxl1 C T 18: 49,878,631 T1285I probably damaging Het
Dnah3 C A 7: 120,047,698 W1036L probably damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dsg2 T A 18: 20,602,245 D1093E possibly damaging Het
Edaradd T A 13: 12,508,423 H12L probably damaging Het
Enam T C 5: 88,492,968 M163T probably benign Het
Fbxo22 T A 9: 55,221,049 V218E probably damaging Het
Fbxo34 A T 14: 47,529,628 K148N probably damaging Het
Foxi3 A G 6: 70,956,976 D149G probably damaging Het
Gbp8 C T 5: 105,041,941 G75D probably damaging Het
Gm10784 C T 13: 49,945,215 noncoding transcript Het
Gm11127 T C 17: 36,057,876 Y104C possibly damaging Het
Gm7247 G A 14: 51,569,594 probably null Het
Grik3 T A 4: 125,650,485 V333E probably damaging Het
Gsap A T 5: 21,226,311 D211V probably damaging Het
Ino80 T C 2: 119,431,008 N725S probably damaging Het
Itgad A G 7: 128,189,531 I443V probably benign Het
Itsn1 T A 16: 91,841,588 I52N probably damaging Het
Kmt2b TCTCCTCCTCCTCCTCCTCCTCCTCC TCTCCTCCTCCTCCTCCTCCTCC 7: 30,586,358 probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Lyn C A 4: 3,738,850 Q41K probably benign Het
Mapk13 C T 17: 28,778,487 R360* probably null Het
Mapk8ip3 T A 17: 24,904,752 I599F probably damaging Het
Me1 T C 9: 86,679,852 K60R probably benign Het
Mga T A 2: 119,941,493 D1532E possibly damaging Het
Miga1 G A 3: 152,279,005 S427L probably benign Het
Mknk2 A T 10: 80,669,339 V186E probably damaging Het
Myo1a C A 10: 127,710,217 N236K probably benign Het
Myt1 A G 2: 181,797,414 D243G probably benign Het
Ncf4 T C 15: 78,255,989 V196A possibly damaging Het
Nlrp5 G T 7: 23,418,178 L442F probably damaging Het
Olfm4 G A 14: 80,021,307 D332N probably benign Het
Olfr1254 C A 2: 89,789,293 V20F probably benign Het
Olfr32 T A 2: 90,139,088 D17V probably damaging Het
Osbpl11 T A 16: 33,196,082 M69K probably benign Het
Oxnad1 T A 14: 32,102,409 *312K probably null Het
Plekhg1 A G 10: 3,956,985 Q634R probably benign Het
Plekhh2 T C 17: 84,575,263 Y733H probably damaging Het
Ppp1r21 A G 17: 88,549,513 H132R probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pudp T C 18: 50,568,188 D158G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Ranbp3 T A 17: 56,696,640 probably null Het
Ranbp6 A G 19: 29,810,321 V877A probably benign Het
Rgsl1 A T 1: 153,817,582 S618T probably benign Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rhox2a A T X: 37,245,362 I61L probably benign Het
Rnf207 A C 4: 152,312,155 D466E probably benign Het
Rnf7 A G 9: 96,471,830 I80T probably benign Het
Ros1 T A 10: 52,129,668 I878F possibly damaging Het
Rsbn1 T A 3: 103,953,780 probably null Het
Sbk1 T C 7: 126,291,129 S105P probably damaging Het
Sdk1 T C 5: 142,006,625 Y790H probably damaging Het
Sec62 T A 3: 30,810,534 N182K unknown Het
Slc15a1 T C 14: 121,478,092 Y345C probably damaging Het
Slc27a1 G A 8: 71,570,764 A15T probably benign Het
Slc35d1 A G 4: 103,213,229 F110L probably damaging Het
Slc39a5 T A 10: 128,397,267 S333C probably benign Het
Tarbp1 A G 8: 126,447,195 S927P probably damaging Het
Tns1 A G 1: 73,953,771 S583P probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trim40 T C 17: 36,882,639 probably null Het
Trim42 C A 9: 97,362,945 V601L probably benign Het
Trpc7 G A 13: 56,887,554 R189C probably damaging Het
Ttc29 A T 8: 78,333,579 Y376F probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vmn2r68 C A 7: 85,221,535 A847S probably benign Het
Wdr63 A G 3: 146,048,167 S713P probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Zfat A G 15: 68,184,476 Y237H probably damaging Het
Zfp236 A T 18: 82,597,659 W1840R probably damaging Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp462 T A 4: 55,009,349 N438K probably benign Het
Zfp952 T A 17: 33,002,925 V88E probably damaging Het
Znfx1 G T 2: 167,056,356 A216D probably benign Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59450172 missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59462094 missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59504226 missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59508063 splice site probably benign
IGL01921:Agtpbp1 APN 13 59512483 missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59500461 missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59500489 missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59528419 missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59482601 missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59474589 missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59532080 splice site probably benign
IGL03218:Agtpbp1 APN 13 59500207 missense possibly damaging 0.94
drunk UTSW 13 59512323 critical splice donor site probably benign
gru UTSW 13 59473746 missense probably damaging 1.00
rio UTSW 13 59525241 critical splice acceptor site probably benign
wobble UTSW 13 59474550 missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59462031 missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59514152 missense probably benign 0.24
R0559:Agtpbp1 UTSW 13 59497000 missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59533939 intron probably benign
R0943:Agtpbp1 UTSW 13 59500602 missense probably benign
R1196:Agtpbp1 UTSW 13 59450318 unclassified probably benign
R1421:Agtpbp1 UTSW 13 59495575 missense possibly damaging 0.86
R1531:Agtpbp1 UTSW 13 59500634 synonymous probably null
R1833:Agtpbp1 UTSW 13 59465983 critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59450202 missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59475803 frame shift probably null
R2006:Agtpbp1 UTSW 13 59500321 missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59474569 missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59497015 missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59460596 missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59500407 missense probably benign 0.01
R4913:Agtpbp1 UTSW 13 59500072 missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59500572 missense probably benign
R4969:Agtpbp1 UTSW 13 59500578 missense probably benign
R5066:Agtpbp1 UTSW 13 59474550 missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59500213 missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59500639 missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59473743 missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59482580 missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59500515 missense probably benign
R5824:Agtpbp1 UTSW 13 59466099 missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59534046 nonsense probably null
R6109:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59450300 missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59500020 missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59477040 missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59544353 intron probably null
R6950:Agtpbp1 UTSW 13 59450266 missense probably benign 0.32
R7030:Agtpbp1 UTSW 13 59504294 missense probably damaging 1.00
R7180:Agtpbp1 UTSW 13 59466038 missense probably benign 0.11
R7196:Agtpbp1 UTSW 13 59533180 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AAGGGCACTGGTAACACTTC -3'
(R):5'- ACATGCTAGGCACCCTCTAC -3'

Sequencing Primer
(F):5'- GCACTGGTAACACTTCTTAGATTTAG -3'
(R):5'- AGGCACCCTCTACCGTTGAC -3'
Posted On2015-10-08