Incidental Mutation 'R4649:Mapk13'
ID350641
Institutional Source Beutler Lab
Gene Symbol Mapk13
Ensembl Gene ENSMUSG00000004864
Gene Namemitogen-activated protein kinase 13
Synonymsp38 delta MAP kinase, SAPK4, Serk4
MMRRC Submission 041910-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4649 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28769307-28778698 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 28778487 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 360 (R360*)
Ref Sequence ENSEMBL: ENSMUSP00000004986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004986] [ENSMUST00000129096]
Predicted Effect probably null
Transcript: ENSMUST00000004986
AA Change: R360*
SMART Domains Protein: ENSMUSP00000004986
Gene: ENSMUSG00000004864
AA Change: R360*

DomainStartEndE-ValueType
S_TKc 25 308 8.72e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124099
Predicted Effect probably benign
Transcript: ENSMUST00000129096
SMART Domains Protein: ENSMUSP00000115659
Gene: ENSMUSG00000004864

DomainStartEndE-ValueType
Pfam:Pkinase 25 209 1.1e-49 PFAM
Pfam:Pkinase_Tyr 27 210 2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133786
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein (MAP) kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit improved glucose tolerance, increased insulin secretion, decreased blood glucose, and decreased susceptibility to diet- or chemically-induced diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,169,893 V841F probably damaging Het
Adcy10 G A 1: 165,504,049 E84K probably damaging Het
Adgrg6 C A 10: 14,468,827 M127I probably damaging Het
Agpat5 A G 8: 18,879,652 I266V possibly damaging Het
Agtpbp1 A T 13: 59,528,399 Y186N possibly damaging Het
Alx1 A T 10: 103,009,332 N279K probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Arsi A G 18: 60,917,098 Y351C probably damaging Het
B4galnt3 T A 6: 120,224,620 R155W probably damaging Het
BC028528 T C 3: 95,888,265 E75G probably damaging Het
Bmp2k C T 5: 97,053,111 P297S possibly damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Bzw2 A T 12: 36,123,981 V98E probably null Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Cd19 A G 7: 126,414,492 S42P probably benign Het
Chml A G 1: 175,687,396 S138P probably benign Het
Clic6 T G 16: 92,530,939 probably null Het
Col12a1 A T 9: 79,639,794 V2252E probably damaging Het
Cplx2 G A 13: 54,379,548 E82K probably benign Het
Csmd2 G A 4: 128,546,073 V3107M probably benign Het
Cspg4 T A 9: 56,886,865 V628D possibly damaging Het
Dcaf13 G A 15: 39,138,242 R315Q possibly damaging Het
Deaf1 A G 7: 141,297,573 V547A possibly damaging Het
Dmxl1 C T 18: 49,878,631 T1285I probably damaging Het
Dnah3 C A 7: 120,047,698 W1036L probably damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dsg2 T A 18: 20,602,245 D1093E possibly damaging Het
Edaradd T A 13: 12,508,423 H12L probably damaging Het
Enam T C 5: 88,492,968 M163T probably benign Het
Fbxo22 T A 9: 55,221,049 V218E probably damaging Het
Fbxo34 A T 14: 47,529,628 K148N probably damaging Het
Foxi3 A G 6: 70,956,976 D149G probably damaging Het
Gbp8 C T 5: 105,041,941 G75D probably damaging Het
Gm10784 C T 13: 49,945,215 noncoding transcript Het
Gm11127 T C 17: 36,057,876 Y104C possibly damaging Het
Gm7247 G A 14: 51,569,594 probably null Het
Grik3 T A 4: 125,650,485 V333E probably damaging Het
Gsap A T 5: 21,226,311 D211V probably damaging Het
Ino80 T C 2: 119,431,008 N725S probably damaging Het
Itgad A G 7: 128,189,531 I443V probably benign Het
Itsn1 T A 16: 91,841,588 I52N probably damaging Het
Kmt2b TCTCCTCCTCCTCCTCCTCCTCCTCC TCTCCTCCTCCTCCTCCTCCTCC 7: 30,586,358 probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Lyn C A 4: 3,738,850 Q41K probably benign Het
Mapk8ip3 T A 17: 24,904,752 I599F probably damaging Het
Me1 T C 9: 86,679,852 K60R probably benign Het
Mga T A 2: 119,941,493 D1532E possibly damaging Het
Miga1 G A 3: 152,279,005 S427L probably benign Het
Mknk2 A T 10: 80,669,339 V186E probably damaging Het
Myo1a C A 10: 127,710,217 N236K probably benign Het
Myt1 A G 2: 181,797,414 D243G probably benign Het
Ncf4 T C 15: 78,255,989 V196A possibly damaging Het
Nlrp5 G T 7: 23,418,178 L442F probably damaging Het
Olfm4 G A 14: 80,021,307 D332N probably benign Het
Olfr1254 C A 2: 89,789,293 V20F probably benign Het
Olfr32 T A 2: 90,139,088 D17V probably damaging Het
Osbpl11 T A 16: 33,196,082 M69K probably benign Het
Oxnad1 T A 14: 32,102,409 *312K probably null Het
Plekhg1 A G 10: 3,956,985 Q634R probably benign Het
Plekhh2 T C 17: 84,575,263 Y733H probably damaging Het
Ppp1r21 A G 17: 88,549,513 H132R probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pudp T C 18: 50,568,188 D158G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Ranbp3 T A 17: 56,696,640 probably null Het
Ranbp6 A G 19: 29,810,321 V877A probably benign Het
Rgsl1 A T 1: 153,817,582 S618T probably benign Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rhox2a A T X: 37,245,362 I61L probably benign Het
Rnf207 A C 4: 152,312,155 D466E probably benign Het
Rnf7 A G 9: 96,471,830 I80T probably benign Het
Ros1 T A 10: 52,129,668 I878F possibly damaging Het
Rsbn1 T A 3: 103,953,780 probably null Het
Sbk1 T C 7: 126,291,129 S105P probably damaging Het
Sdk1 T C 5: 142,006,625 Y790H probably damaging Het
Sec62 T A 3: 30,810,534 N182K unknown Het
Slc15a1 T C 14: 121,478,092 Y345C probably damaging Het
Slc27a1 G A 8: 71,570,764 A15T probably benign Het
Slc35d1 A G 4: 103,213,229 F110L probably damaging Het
Slc39a5 T A 10: 128,397,267 S333C probably benign Het
Tarbp1 A G 8: 126,447,195 S927P probably damaging Het
Tns1 A G 1: 73,953,771 S583P probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trim40 T C 17: 36,882,639 probably null Het
Trim42 C A 9: 97,362,945 V601L probably benign Het
Trpc7 G A 13: 56,887,554 R189C probably damaging Het
Ttc29 A T 8: 78,333,579 Y376F probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vmn2r68 C A 7: 85,221,535 A847S probably benign Het
Wdr63 A G 3: 146,048,167 S713P probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Zfat A G 15: 68,184,476 Y237H probably damaging Het
Zfp236 A T 18: 82,597,659 W1840R probably damaging Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp462 T A 4: 55,009,349 N438K probably benign Het
Zfp952 T A 17: 33,002,925 V88E probably damaging Het
Znfx1 G T 2: 167,056,356 A216D probably benign Het
Other mutations in Mapk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Mapk13 APN 17 28776405 missense probably damaging 1.00
IGL01918:Mapk13 APN 17 28775330 missense probably damaging 1.00
IGL02265:Mapk13 APN 17 28777718 splice site probably benign
IGL02451:Mapk13 APN 17 28776413 missense probably damaging 1.00
IGL02977:Mapk13 APN 17 28776348 missense probably damaging 1.00
IGL03118:Mapk13 APN 17 28777735 missense probably benign 0.14
IGL03188:Mapk13 APN 17 28776583 intron probably benign
R0501:Mapk13 UTSW 17 28776353 missense probably damaging 1.00
R0538:Mapk13 UTSW 17 28775255 missense probably damaging 1.00
R2240:Mapk13 UTSW 17 28778111 missense probably damaging 0.98
R4368:Mapk13 UTSW 17 28777565 splice site probably null
R4613:Mapk13 UTSW 17 28769452 missense probably damaging 1.00
R4684:Mapk13 UTSW 17 28770049 missense probably damaging 1.00
R4796:Mapk13 UTSW 17 28775554 missense probably damaging 1.00
R4863:Mapk13 UTSW 17 28776310 missense probably damaging 1.00
R4923:Mapk13 UTSW 17 28778223 missense probably benign
R5220:Mapk13 UTSW 17 28778491 missense probably benign 0.00
R5247:Mapk13 UTSW 17 28777751 missense probably benign 0.01
R5370:Mapk13 UTSW 17 28776352 nonsense probably null
R6838:Mapk13 UTSW 17 28777561 splice site probably null
R6843:Mapk13 UTSW 17 28775453 intron probably null
R7187:Mapk13 UTSW 17 28776387 missense probably damaging 1.00
Z1088:Mapk13 UTSW 17 28777533 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGGTAGCTGTCCATCTCCTG -3'
(R):5'- AAGTGCCTGAGTTTGAGAGATGC -3'

Sequencing Primer
(F):5'- CTGTCCATCTCCTGTGGGG -3'
(R):5'- AGTGGTGCATGCCTTTAATCC -3'
Posted On2015-10-08