Incidental Mutation 'R3983:Gdap1'
ID350658
Institutional Source Beutler Lab
Gene Symbol Gdap1
Ensembl Gene ENSMUSG00000025777
Gene Nameganglioside-induced differentiation-associated-protein 1
Synonyms
MMRRC Submission 040944-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3983 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location17145362-17164271 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 17159907 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026879] [ENSMUST00000189736]
Predicted Effect probably benign
Transcript: ENSMUST00000026879
SMART Domains Protein: ENSMUSP00000026879
Gene: ENSMUSG00000025777

DomainStartEndE-ValueType
Pfam:GST_N 24 99 2.8e-15 PFAM
Pfam:GST_N_3 28 105 8.1e-18 PFAM
Pfam:GST_N_2 33 100 2.7e-12 PFAM
Pfam:GST_C 148 287 3.5e-10 PFAM
Pfam:GST_C_2 160 282 5.8e-13 PFAM
Pfam:GST_C_3 164 285 8.5e-10 PFAM
transmembrane domain 292 309 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189465
Predicted Effect probably benign
Transcript: ENSMUST00000189736
SMART Domains Protein: ENSMUSP00000140406
Gene: ENSMUSG00000025777

DomainStartEndE-ValueType
SCOP:d1eema2 19 55 4e-5 SMART
Meta Mutation Damage Score 0.1064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ganglioside-induced differentiation-associated protein family, which may play a role in a signal transduction pathway during neuronal development. Mutations in this gene have been associated with various forms of Charcot-Marie-Tooth Disease and neuropathy. Two transcript variants encoding different isoforms and a noncoding variant have been identified for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele develop motor deficits and a peripheral neuropathy with loss of motor neurons and abnormal neuromuscular junctions. Cultured motor neurons show large and abnormal mitochondria, reduced axon length, changes in the ER cisternae, and altered calcium ion homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,517,220 N138Y possibly damaging Het
4921504E06Rik A G 2: 19,542,369 probably null Het
Abcc6 T C 7: 45,995,289 I821V probably benign Het
Adam34 G A 8: 43,650,769 T613I probably benign Het
AF067061 G T 13: 120,264,279 A160S possibly damaging Het
Ap2b1 C T 11: 83,390,716 T816M probably damaging Het
BC005561 T C 5: 104,521,023 V1137A probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cdc23 C A 18: 34,637,486 probably benign Het
Chrna2 G T 14: 66,149,457 V351L probably benign Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cyp2c50 A C 19: 40,113,518 K400T possibly damaging Het
Cyp2c54 G T 19: 40,046,255 Q324K possibly damaging Het
Dcpp2 T A 17: 23,900,573 Y120* probably null Het
Ddx11 C T 17: 66,134,130 R242W probably damaging Het
Dnah7b T A 1: 46,233,711 V2333E possibly damaging Het
Eno3 T A 11: 70,661,411 F296L probably damaging Het
Flnc G A 6: 29,442,941 V492M probably damaging Het
Gm1587 C T 14: 77,794,843 E118K unknown Het
Gm4981 T A 10: 58,235,801 N197I possibly damaging Het
Gprin3 T C 6: 59,354,560 E254G possibly damaging Het
Hcrt G A 11: 100,761,853 R112C probably damaging Het
Hoxa4 A T 6: 52,190,677 Y175N probably benign Het
Hydin G A 8: 110,392,325 G504R probably damaging Het
Il1rl1 A G 1: 40,446,663 R325G possibly damaging Het
Kcp A T 6: 29,484,637 L1314Q probably damaging Het
Kdm5b C T 1: 134,631,304 P1522L possibly damaging Het
Kmt2d T G 15: 98,846,046 probably benign Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Msr1 A G 8: 39,620,018 V164A possibly damaging Het
Mybbp1a T C 11: 72,447,170 V646A probably damaging Het
Mybpc3 A T 2: 91,135,369 K1175N probably benign Het
Myo1c T A 11: 75,661,499 L366Q probably benign Het
Olfr105-ps T C 17: 37,383,398 V277A possibly damaging Het
Olfr308 A G 7: 86,321,734 Y73H probably damaging Het
Olfr381 A G 11: 73,486,135 S230P possibly damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Pde4d A G 13: 109,740,406 T29A probably benign Het
Rapgef5 A G 12: 117,728,670 E563G possibly damaging Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Rnf44 A C 13: 54,683,148 S98R probably damaging Het
Samhd1 C A 2: 157,123,449 V149L possibly damaging Het
Scn4a G T 11: 106,347,818 N214K probably damaging Het
Sh3bp4 A G 1: 89,145,869 N813S probably benign Het
Sirt3 A T 7: 140,878,112 C41* probably null Het
Speg C A 1: 75,422,547 P2213T probably benign Het
Srcin1 T G 11: 97,525,553 E951A probably damaging Het
Syn2 C G 6: 115,237,298 T161S probably benign Het
Tbc1d4 T C 14: 101,507,213 T326A probably benign Het
Tes T A 6: 17,099,701 probably null Het
Tln1 T C 4: 43,553,030 T354A probably damaging Het
Ttn G T 2: 76,802,361 S12370R possibly damaging Het
Twsg1 T C 17: 65,929,763 T91A probably benign Het
Vmn1r181 C T 7: 23,984,809 T233I probably benign Het
Wee2 A T 6: 40,455,241 N248I possibly damaging Het
Zfp740 G T 15: 102,208,243 C56F probably benign Het
Other mutations in Gdap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02424:Gdap1 APN 1 17161178 missense probably damaging 1.00
IGL02570:Gdap1 APN 1 17145485 missense probably benign 0.27
IGL03269:Gdap1 APN 1 17161505 missense probably benign 0.00
R0992:Gdap1 UTSW 1 17147105 missense probably damaging 1.00
R1480:Gdap1 UTSW 1 17145557 missense probably damaging 1.00
R1518:Gdap1 UTSW 1 17146945 missense possibly damaging 0.54
R2061:Gdap1 UTSW 1 17145465 unclassified probably benign
R4892:Gdap1 UTSW 1 17159994 missense possibly damaging 0.61
R5765:Gdap1 UTSW 1 17161426 missense probably benign
R6471:Gdap1 UTSW 1 17160025 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGATCTCACAGCTGGACTATTTCC -3'
(R):5'- GAGGGGTCTGAAAATGTTCCTAC -3'

Sequencing Primer
(F):5'- ACAGCTGGACTATTTCCTCATTTCAC -3'
(R):5'- GGGGTCTGAAAATGTTCCTACAAATG -3'
Posted On2015-10-08