Incidental Mutation 'R3983:4921504E06Rik'
ID350665
Institutional Source Beutler Lab
Gene Symbol 4921504E06Rik
Ensembl Gene ENSMUSG00000026734
Gene NameRIKEN cDNA 4921504E06 gene
Synonyms
MMRRC Submission 040944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3983 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location19462837-19553914 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 19542369 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062060]
Predicted Effect probably null
Transcript: ENSMUST00000062060
SMART Domains Protein: ENSMUSP00000058720
Gene: ENSMUSG00000026734

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:DUF4709 36 145 1e-45 PFAM
coiled coil region 165 257 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
coiled coil region 417 463 N/A INTRINSIC
Pfam:DUF4724 477 559 3.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131199
Meta Mutation Damage Score 0.5972 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,517,220 N138Y possibly damaging Het
Abcc6 T C 7: 45,995,289 I821V probably benign Het
Adam34 G A 8: 43,650,769 T613I probably benign Het
AF067061 G T 13: 120,264,279 A160S possibly damaging Het
Ap2b1 C T 11: 83,390,716 T816M probably damaging Het
BC005561 T C 5: 104,521,023 V1137A probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cdc23 C A 18: 34,637,486 probably benign Het
Chrna2 G T 14: 66,149,457 V351L probably benign Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cyp2c50 A C 19: 40,113,518 K400T possibly damaging Het
Cyp2c54 G T 19: 40,046,255 Q324K possibly damaging Het
Dcpp2 T A 17: 23,900,573 Y120* probably null Het
Ddx11 C T 17: 66,134,130 R242W probably damaging Het
Dnah7b T A 1: 46,233,711 V2333E possibly damaging Het
Eno3 T A 11: 70,661,411 F296L probably damaging Het
Flnc G A 6: 29,442,941 V492M probably damaging Het
Gdap1 T G 1: 17,159,907 probably benign Het
Gm1587 C T 14: 77,794,843 E118K unknown Het
Gm4981 T A 10: 58,235,801 N197I possibly damaging Het
Gprin3 T C 6: 59,354,560 E254G possibly damaging Het
Hcrt G A 11: 100,761,853 R112C probably damaging Het
Hoxa4 A T 6: 52,190,677 Y175N probably benign Het
Hydin G A 8: 110,392,325 G504R probably damaging Het
Il1rl1 A G 1: 40,446,663 R325G possibly damaging Het
Kcp A T 6: 29,484,637 L1314Q probably damaging Het
Kdm5b C T 1: 134,631,304 P1522L possibly damaging Het
Kmt2d T G 15: 98,846,046 probably benign Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Msr1 A G 8: 39,620,018 V164A possibly damaging Het
Mybbp1a T C 11: 72,447,170 V646A probably damaging Het
Mybpc3 A T 2: 91,135,369 K1175N probably benign Het
Myo1c T A 11: 75,661,499 L366Q probably benign Het
Olfr105-ps T C 17: 37,383,398 V277A possibly damaging Het
Olfr308 A G 7: 86,321,734 Y73H probably damaging Het
Olfr381 A G 11: 73,486,135 S230P possibly damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Pde4d A G 13: 109,740,406 T29A probably benign Het
Rapgef5 A G 12: 117,728,670 E563G possibly damaging Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Rnf44 A C 13: 54,683,148 S98R probably damaging Het
Samhd1 C A 2: 157,123,449 V149L possibly damaging Het
Scn4a G T 11: 106,347,818 N214K probably damaging Het
Sh3bp4 A G 1: 89,145,869 N813S probably benign Het
Sirt3 A T 7: 140,878,112 C41* probably null Het
Speg C A 1: 75,422,547 P2213T probably benign Het
Srcin1 T G 11: 97,525,553 E951A probably damaging Het
Syn2 C G 6: 115,237,298 T161S probably benign Het
Tbc1d4 T C 14: 101,507,213 T326A probably benign Het
Tes T A 6: 17,099,701 probably null Het
Tln1 T C 4: 43,553,030 T354A probably damaging Het
Ttn G T 2: 76,802,361 S12370R possibly damaging Het
Twsg1 T C 17: 65,929,763 T91A probably benign Het
Vmn1r181 C T 7: 23,984,809 T233I probably benign Het
Wee2 A T 6: 40,455,241 N248I possibly damaging Het
Zfp740 G T 15: 102,208,243 C56F probably benign Het
Other mutations in 4921504E06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:4921504E06Rik APN 2 19540371 missense probably benign 0.06
IGL01590:4921504E06Rik APN 2 19477779 splice site probably benign
IGL02264:4921504E06Rik APN 2 19542369 splice site probably null
IGL02591:4921504E06Rik APN 2 19480438 missense probably benign 0.26
H8786:4921504E06Rik UTSW 2 19494094 missense probably benign 0.04
R0545:4921504E06Rik UTSW 2 19542376 missense probably damaging 1.00
R0762:4921504E06Rik UTSW 2 19477856 missense probably damaging 0.97
R1325:4921504E06Rik UTSW 2 19495127 missense possibly damaging 0.71
R1456:4921504E06Rik UTSW 2 19480920 critical splice donor site probably null
R2013:4921504E06Rik UTSW 2 19540313 missense probably benign 0.01
R2089:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R2091:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R2091:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R3922:4921504E06Rik UTSW 2 19480560 missense probably benign 0.00
R3982:4921504E06Rik UTSW 2 19542369 splice site probably null
R4074:4921504E06Rik UTSW 2 19480590 missense probably damaging 0.96
R4995:4921504E06Rik UTSW 2 19494184 nonsense probably null
R5303:4921504E06Rik UTSW 2 19516299 missense possibly damaging 0.92
R5308:4921504E06Rik UTSW 2 19524081 missense probably damaging 1.00
R6227:4921504E06Rik UTSW 2 19553770 splice site probably null
R6253:4921504E06Rik UTSW 2 19524118 missense possibly damaging 0.53
R6268:4921504E06Rik UTSW 2 19540408 missense probably benign 0.10
R6496:4921504E06Rik UTSW 2 19540406 missense probably benign 0.17
R7196:4921504E06Rik UTSW 2 19493995 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCAAAGACCTTCATGTTTTGAAAC -3'
(R):5'- CCTCCAAATATGATTGCTTGCC -3'

Sequencing Primer
(F):5'- GAGCTTGATTTTCAGGGCT -3'
(R):5'- CCAAATATGATTGCTTGCCTTTTTC -3'
Posted On2015-10-08