Incidental Mutation 'R3983:Tln1'
ID350672
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
MMRRC Submission 040944-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3983 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43553030 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 354 (T354A)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187] [ENSMUST00000130353]
PDB Structure
Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000030187
AA Change: T354A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: T354A

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125509
SMART Domains Protein: ENSMUSP00000115681
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:IRS 2 28 2e-9 BLAST
PDB:2G35|A 2 29 3e-11 PDB
Pfam:Talin_middle 32 193 1.8e-61 PFAM
PDB:2L7A|A 215 279 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127262
Predicted Effect probably benign
Transcript: ENSMUST00000130353
SMART Domains Protein: ENSMUSP00000119441
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
Blast:B41 1 39 9e-7 BLAST
B41 82 241 6.58e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130670
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,517,220 N138Y possibly damaging Het
4921504E06Rik A G 2: 19,542,369 probably null Het
Abcc6 T C 7: 45,995,289 I821V probably benign Het
Adam34 G A 8: 43,650,769 T613I probably benign Het
AF067061 G T 13: 120,264,279 A160S possibly damaging Het
Ap2b1 C T 11: 83,390,716 T816M probably damaging Het
BC005561 T C 5: 104,521,023 V1137A probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cdc23 C A 18: 34,637,486 probably benign Het
Chrna2 G T 14: 66,149,457 V351L probably benign Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cyp2c50 A C 19: 40,113,518 K400T possibly damaging Het
Cyp2c54 G T 19: 40,046,255 Q324K possibly damaging Het
Dcpp2 T A 17: 23,900,573 Y120* probably null Het
Ddx11 C T 17: 66,134,130 R242W probably damaging Het
Dnah7b T A 1: 46,233,711 V2333E possibly damaging Het
Eno3 T A 11: 70,661,411 F296L probably damaging Het
Flnc G A 6: 29,442,941 V492M probably damaging Het
Gdap1 T G 1: 17,159,907 probably benign Het
Gm1587 C T 14: 77,794,843 E118K unknown Het
Gm4981 T A 10: 58,235,801 N197I possibly damaging Het
Gprin3 T C 6: 59,354,560 E254G possibly damaging Het
Hcrt G A 11: 100,761,853 R112C probably damaging Het
Hoxa4 A T 6: 52,190,677 Y175N probably benign Het
Hydin G A 8: 110,392,325 G504R probably damaging Het
Il1rl1 A G 1: 40,446,663 R325G possibly damaging Het
Kcp A T 6: 29,484,637 L1314Q probably damaging Het
Kdm5b C T 1: 134,631,304 P1522L possibly damaging Het
Kmt2d T G 15: 98,846,046 probably benign Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Msr1 A G 8: 39,620,018 V164A possibly damaging Het
Mybbp1a T C 11: 72,447,170 V646A probably damaging Het
Mybpc3 A T 2: 91,135,369 K1175N probably benign Het
Myo1c T A 11: 75,661,499 L366Q probably benign Het
Olfr105-ps T C 17: 37,383,398 V277A possibly damaging Het
Olfr308 A G 7: 86,321,734 Y73H probably damaging Het
Olfr381 A G 11: 73,486,135 S230P possibly damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Pde4d A G 13: 109,740,406 T29A probably benign Het
Rapgef5 A G 12: 117,728,670 E563G possibly damaging Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Rnf44 A C 13: 54,683,148 S98R probably damaging Het
Samhd1 C A 2: 157,123,449 V149L possibly damaging Het
Scn4a G T 11: 106,347,818 N214K probably damaging Het
Sh3bp4 A G 1: 89,145,869 N813S probably benign Het
Sirt3 A T 7: 140,878,112 C41* probably null Het
Speg C A 1: 75,422,547 P2213T probably benign Het
Srcin1 T G 11: 97,525,553 E951A probably damaging Het
Syn2 C G 6: 115,237,298 T161S probably benign Het
Tbc1d4 T C 14: 101,507,213 T326A probably benign Het
Tes T A 6: 17,099,701 probably null Het
Ttn G T 2: 76,802,361 S12370R possibly damaging Het
Twsg1 T C 17: 65,929,763 T91A probably benign Het
Vmn1r181 C T 7: 23,984,809 T233I probably benign Het
Wee2 A T 6: 40,455,241 N248I possibly damaging Het
Zfp740 G T 15: 102,208,243 C56F probably benign Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 unclassified probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4737:Tln1 UTSW 4 43540588 missense probably benign 0.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAAGAACGTCTCCATCTCCTC -3'
(R):5'- AGCACAGTTGTTTAGCCCTCC -3'

Sequencing Primer
(F):5'- AGAACGTCTCCATCTCCTCTAACTTC -3'
(R):5'- CTTGTGGTCCAGAGCTGCTC -3'
Posted On2015-10-08