Incidental Mutation 'R4637:Hcn1'
ID350770
Institutional Source Beutler Lab
Gene Symbol Hcn1
Ensembl Gene ENSMUSG00000021730
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 1
SynonymsHAC2, Bcng1, C630013B14Rik
MMRRC Submission 042010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4637 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location117602320-117987418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117975713 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 738 (T738S)
Ref Sequence ENSEMBL: ENSMUSP00000006991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006991]
PDB Structure
Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000006991
AA Change: T738S
SMART Domains Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: T738S

DomainStartEndE-ValueType
Pfam:Ion_trans_N 87 130 8.2e-24 PFAM
Pfam:Ion_trans 131 394 2.1e-23 PFAM
low complexity region 395 406 N/A INTRINSIC
Blast:cNMP 407 439 4e-13 BLAST
cNMP 464 580 1.95e-22 SMART
low complexity region 639 655 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 720 779 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Art1 T A 7: 102,106,337 V12E probably damaging Het
Ccdc180 A G 4: 45,914,443 S653G probably benign Het
Clic6 T C 16: 92,497,061 probably benign Het
Fras1 T A 5: 96,778,088 L3717Q probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Gtf2f1 G T 17: 57,004,534 P292H probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmbs A G 9: 44,339,537 S130P probably damaging Het
Kif1b A T 4: 149,199,311 I1299N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc3 A T 5: 137,146,654 L56Q probably damaging Het
Myd88 G A 9: 119,338,109 probably null Het
Nol6 G A 4: 41,121,788 R249W probably damaging Het
Olfr1284 C T 2: 111,379,582 T194I probably benign Het
Pcdhb1 T C 18: 37,265,749 V251A possibly damaging Het
Prkcd A G 14: 30,598,765 S633P probably benign Het
Rarb T C 14: 16,574,875 H47R possibly damaging Het
Slc16a14 A G 1: 84,907,282 V512A possibly damaging Het
Slc34a3 C T 2: 25,229,461 V466M possibly damaging Het
Stat3 A G 11: 100,893,230 S623P probably damaging Het
Vmn2r16 T G 5: 109,330,414 S12A probably benign Het
Zfhx4 C G 3: 5,403,404 P2874R probably damaging Het
Zfp3 T C 11: 70,771,355 S47P probably benign Het
Zfp791 T C 8: 85,109,885 E450G possibly damaging Het
Other mutations in Hcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Hcn1 APN 13 117975993 missense probably damaging 1.00
IGL00340:Hcn1 APN 13 117602977 missense unknown
IGL01161:Hcn1 APN 13 117656922 missense unknown
IGL01723:Hcn1 APN 13 117976055 missense probably damaging 0.98
IGL02324:Hcn1 APN 13 117902886 missense unknown
IGL02491:Hcn1 APN 13 117810040 missense unknown
Thump UTSW 13 117873905 nonsense probably null
FR4976:Hcn1 UTSW 13 117975808 small insertion probably benign
PIT4504001:Hcn1 UTSW 13 117975875 missense possibly damaging 0.90
R0420:Hcn1 UTSW 13 117975375 missense unknown
R1546:Hcn1 UTSW 13 117975766 small insertion probably benign
R1558:Hcn1 UTSW 13 117975576 missense unknown
R1659:Hcn1 UTSW 13 117976074 missense probably damaging 0.99
R1667:Hcn1 UTSW 13 117603073 missense unknown
R1766:Hcn1 UTSW 13 117656734 missense probably benign 0.39
R1842:Hcn1 UTSW 13 117976008 missense probably damaging 0.99
R2051:Hcn1 UTSW 13 117976083 missense probably damaging 0.99
R3605:Hcn1 UTSW 13 117975252 missense unknown
R4259:Hcn1 UTSW 13 117975348 missense unknown
R4284:Hcn1 UTSW 13 117975733 small deletion probably benign
R4679:Hcn1 UTSW 13 117657015 missense probably benign 0.39
R4777:Hcn1 UTSW 13 117975733 small deletion probably benign
R4839:Hcn1 UTSW 13 117925710 missense unknown
R4883:Hcn1 UTSW 13 117902895 critical splice donor site probably null
R5015:Hcn1 UTSW 13 117603020 missense unknown
R5060:Hcn1 UTSW 13 117873905 nonsense probably null
R5748:Hcn1 UTSW 13 117976055 missense probably damaging 0.99
R5823:Hcn1 UTSW 13 117602852 missense unknown
R6900:Hcn1 UTSW 13 117656827 missense probably benign 0.39
R7045:Hcn1 UTSW 13 117975462 missense unknown
R7049:Hcn1 UTSW 13 117975462 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTGTCTCACAGCAATCTG -3'
(R):5'- AAGGGGCCTGACTTCTTTG -3'

Sequencing Primer
(F):5'- GCAATCTGCACTCACCCAGTC -3'
(R):5'- CAGGTTGGTGTTATGAAGGGC -3'
Posted On2015-10-08