Incidental Mutation 'R4638:Sp2'
ID350803
Institutional Source Beutler Lab
Gene Symbol Sp2
Ensembl Gene ENSMUSG00000018678
Gene NameSp2 transcription factor
Synonyms
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location96953341-96982959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96957474 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 435 (I435T)
Ref Sequence ENSEMBL: ENSMUSP00000103249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062652] [ENSMUST00000107623] [ENSMUST00000107624]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062652
AA Change: I435T

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051403
Gene: ENSMUSG00000018678
AA Change: I435T

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107623
AA Change: I435T

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103249
Gene: ENSMUSG00000018678
AA Change: I435T

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107624
AA Change: I441T

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103250
Gene: ENSMUSG00000018678
AA Change: I441T

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
low complexity region 281 313 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
ZnF_C2H2 519 543 5.14e-3 SMART
ZnF_C2H2 549 573 8.47e-4 SMART
ZnF_C2H2 579 601 3.58e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107626
AA Change: I441T

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103252
Gene: ENSMUSG00000018678
AA Change: I441T

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
low complexity region 209 222 N/A INTRINSIC
low complexity region 287 319 N/A INTRINSIC
low complexity region 371 381 N/A INTRINSIC
low complexity region 426 437 N/A INTRINSIC
ZnF_C2H2 525 549 5.14e-3 SMART
ZnF_C2H2 555 579 8.47e-4 SMART
ZnF_C2H2 585 607 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186326
Meta Mutation Damage Score 0.378 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: This gene encodes a member of the Sp subfamily of Sp/XKLF transcription factors. Sp family proteins are sequence-specific DNA-binding proteins characterized by an amino-terminal trans-activation domain and three carboxy-terminal zinc finger motifs. This protein contains the least conserved DNA-binding domain within the Sp subfamily of proteins, and its DNA sequence specificity differs from the other Sp proteins. The protein can act as a transcriptional activator or repressor, depending on the promoter and cell type. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: No homozygous null mice survived beyond E10.5, with decrease embryo size and embryonic growth retardation starting at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Sp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00228:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00467:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00470:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00476:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00505:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL00535:Sp2 APN 11 96954561 missense probably damaging 1.00
IGL01865:Sp2 APN 11 96961042 missense probably damaging 1.00
IGL02170:Sp2 APN 11 96956210 missense probably damaging 0.99
IGL03342:Sp2 APN 11 96961762 missense probably damaging 0.99
PIT4696001:Sp2 UTSW 11 96961973 missense probably damaging 1.00
R0082:Sp2 UTSW 11 96961699 missense probably damaging 1.00
R0086:Sp2 UTSW 11 96957427 missense probably damaging 1.00
R0525:Sp2 UTSW 11 96956098 critical splice donor site probably benign
R0789:Sp2 UTSW 11 96961376 missense probably benign 0.18
R1463:Sp2 UTSW 11 96963456 critical splice acceptor site probably benign
R1941:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2049:Sp2 UTSW 11 96961365 missense probably benign 0.09
R2153:Sp2 UTSW 11 96962008 missense possibly damaging 0.92
R2230:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2232:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2237:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2238:Sp2 UTSW 11 96955936 missense probably damaging 1.00
R2247:Sp2 UTSW 11 96962018 splice site probably null
R5016:Sp2 UTSW 11 96955832 missense probably damaging 0.96
R5099:Sp2 UTSW 11 96961349 missense probably damaging 0.99
R5125:Sp2 UTSW 11 96955838 missense probably benign 0.00
R5178:Sp2 UTSW 11 96955838 missense probably benign 0.00
R5828:Sp2 UTSW 11 96960985 intron probably benign
R6286:Sp2 UTSW 11 96961546 missense probably benign 0.01
R6997:Sp2 UTSW 11 96957726 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATCTGCAGTTATCATGTGGTC -3'
(R):5'- TCAACCGTCACCTGTAACAG -3'

Sequencing Primer
(F):5'- CAGATATGACCTGAGGCTGGC -3'
(R):5'- GTCACCTGTAACAGCCCTG -3'
Posted On2015-10-08