Incidental Mutation 'R4608:Fmnl2'
ID350859
Institutional Source Beutler Lab
Gene Symbol Fmnl2
Ensembl Gene ENSMUSG00000036053
Gene Nameformin-like 2
Synonyms5430425K04Rik, man
MMRRC Submission 041819-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R4608 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52857860-53133804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53103716 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 374 (N374K)
Ref Sequence ENSEMBL: ENSMUSP00000057084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049483] [ENSMUST00000050719] [ENSMUST00000090952] [ENSMUST00000127122] [ENSMUST00000155586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049483
AA Change: N374K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047260
Gene: ENSMUSG00000036053
AA Change: N374K

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 8e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000050719
AA Change: N374K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057084
Gene: ENSMUSG00000036053
AA Change: N374K

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
FH2 581 1018 1.66e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090952
AA Change: N374K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088472
Gene: ENSMUSG00000036053
AA Change: N374K

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 6e-3 SMART
FH2 615 1052 1.66e-124 SMART
low complexity region 1063 1075 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127122
AA Change: N374K

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118658
Gene: ENSMUSG00000036053
AA Change: N374K

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 7e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155586
AA Change: N374K

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117822
Gene: ENSMUSG00000036053
AA Change: N374K

DomainStartEndE-ValueType
Pfam:FH2 1 131 2e-33 PFAM
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,418,029 I74V unknown Het
Acss3 T A 10: 106,967,029 I452F possibly damaging Het
Adam10 T C 9: 70,743,891 L66P probably damaging Het
Adamts18 A T 8: 113,737,613 C738S probably damaging Het
Adamts7 T G 9: 90,174,540 S221A probably damaging Het
Adrm1 A G 2: 180,174,855 probably benign Het
Aqp1 T C 6: 55,336,639 V50A possibly damaging Het
Aqp4 T C 18: 15,398,126 I193V probably benign Het
B130006D01Rik A T 11: 95,726,240 probably benign Het
Bbs10 T G 10: 111,300,820 I598S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Ccnl1 C T 3: 65,946,710 probably benign Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcdc2a T A 13: 25,061,240 L100* probably null Het
Eif4g3 G T 4: 138,126,458 R618L probably benign Het
F5 C T 1: 164,209,029 P1920S probably benign Het
Fam187b T A 7: 30,977,745 N226K probably benign Het
Fancc C A 13: 63,331,823 probably benign Het
Fastk G T 5: 24,443,119 P233H probably damaging Het
Fbn1 A C 2: 125,306,500 D2609E probably benign Het
Fes G A 7: 80,387,211 R42W probably damaging Het
Fpgt G A 3: 155,086,696 Q565* probably null Het
Gckr A G 5: 31,307,797 D370G probably damaging Het
Ggt6 T C 11: 72,437,943 M385T probably benign Het
Gm26657 C A 4: 56,741,114 H100N probably benign Het
Gm6588 A G 5: 112,449,898 S104G possibly damaging Het
Gsg1l T A 7: 125,958,549 I136F probably damaging Het
Hhip C T 8: 79,997,563 R350Q probably damaging Het
Ints1 C T 5: 139,759,844 S1353N probably benign Het
Ints10 G A 8: 68,810,619 R394Q probably damaging Het
Ints6 T G 14: 62,703,229 R557S probably damaging Het
Ints9 T A 14: 65,032,280 I473N possibly damaging Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kif1a C A 1: 93,024,646 A1304S possibly damaging Het
Kif21b C T 1: 136,148,186 probably benign Het
Klk13 C A 7: 43,713,860 C10* probably null Het
Krtap4-8 C T 11: 99,780,495 probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Leng8 T A 7: 4,144,797 I607N probably damaging Het
Lrch4 T A 5: 137,639,146 L526* probably null Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Nod1 C A 6: 54,943,756 A526S probably damaging Het
Nostrin G A 2: 69,183,899 V400M possibly damaging Het
Nrip1 T C 16: 76,293,032 T546A probably benign Het
Nxf1 A G 19: 8,762,763 D98G probably benign Het
Olfr1219 G T 2: 89,074,312 P260T probably benign Het
Olfr303 A T 7: 86,394,510 probably null Het
Olfr31 A G 14: 14,328,887 M259V probably benign Het
Olfr365 T A 2: 37,202,082 Y280* probably null Het
Olfr538 A G 7: 140,574,641 M163V probably benign Het
Olfr753-ps1 A T 17: 37,170,282 V20E probably damaging Het
Osgep T C 14: 50,917,921 Y60C probably damaging Het
P2ry6 A G 7: 100,938,304 Y283H probably damaging Het
Pcdha7 A T 18: 36,975,817 S632C possibly damaging Het
Pms1 T A 1: 53,194,938 R806S possibly damaging Het
Qars T A 9: 108,509,426 probably null Het
Rxfp1 T C 3: 79,686,889 N66S probably damaging Het
Slc12a5 A T 2: 164,973,765 N67I probably damaging Het
Slc1a4 G T 11: 20,304,348 T506K probably damaging Het
Tlr9 T A 9: 106,224,974 I488N probably damaging Het
Tmem110 C A 14: 30,872,533 probably benign Het
Tmem74 G T 15: 43,867,158 T163K probably damaging Het
Uba2 T C 7: 34,154,596 D307G probably damaging Het
Uty C T Y: 1,131,134 R924Q probably damaging Het
Wdr7 C T 18: 63,777,580 T681I probably benign Het
Xab2 A G 8: 3,618,105 S158P probably benign Het
Ythdc1 T C 5: 86,822,808 S418P probably damaging Het
Zfand4 T A 6: 116,328,234 C207* probably null Het
Zfp367 C T 13: 64,135,424 D305N probably damaging Het
Zfp804b C T 5: 6,772,584 V160I probably benign Het
Other mutations in Fmnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fmnl2 APN 2 53114917 missense probably damaging 1.00
IGL00960:Fmnl2 APN 2 53123482 missense probably damaging 0.98
IGL01343:Fmnl2 APN 2 53123545 missense probably damaging 1.00
IGL01790:Fmnl2 APN 2 53118368 missense probably damaging 1.00
IGL02555:Fmnl2 APN 2 53126851 critical splice acceptor site probably null
IGL02613:Fmnl2 APN 2 53073735 critical splice donor site probably null
IGL02712:Fmnl2 APN 2 53036498 splice site probably benign
IGL02715:Fmnl2 APN 2 53072210 missense possibly damaging 0.93
IGL02750:Fmnl2 APN 2 53103697 missense possibly damaging 0.95
IGL02832:Fmnl2 APN 2 52858249 missense possibly damaging 0.90
IGL02975:Fmnl2 APN 2 53101482 missense probably benign 0.45
R0529:Fmnl2 UTSW 2 53042365 missense probably damaging 1.00
R0571:Fmnl2 UTSW 2 53054491 missense probably benign 0.01
R0707:Fmnl2 UTSW 2 53054486 missense possibly damaging 0.85
R1172:Fmnl2 UTSW 2 53072274 missense probably damaging 1.00
R1473:Fmnl2 UTSW 2 52858207 missense possibly damaging 0.53
R1533:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1536:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1537:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1547:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1548:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1549:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1604:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1608:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1615:Fmnl2 UTSW 2 53118424 missense probably damaging 1.00
R1792:Fmnl2 UTSW 2 53042317 missense possibly damaging 0.79
R1965:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R1970:Fmnl2 UTSW 2 53105576 missense possibly damaging 0.93
R2012:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2065:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2111:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2112:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2427:Fmnl2 UTSW 2 53116979 missense probably damaging 0.96
R4084:Fmnl2 UTSW 2 53107495 missense possibly damaging 0.96
R4095:Fmnl2 UTSW 2 53101523 missense probably damaging 0.99
R4607:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4720:Fmnl2 UTSW 2 53107540 missense possibly damaging 0.96
R4731:Fmnl2 UTSW 2 53117069 missense possibly damaging 0.95
R4947:Fmnl2 UTSW 2 53073710 missense probably benign 0.32
R5015:Fmnl2 UTSW 2 53103761 missense possibly damaging 0.85
R5402:Fmnl2 UTSW 2 53128782 missense probably damaging 0.97
R5731:Fmnl2 UTSW 2 53118137 intron probably null
R5766:Fmnl2 UTSW 2 53101454 missense probably damaging 1.00
R5945:Fmnl2 UTSW 2 53114199 missense probably damaging 0.99
R6093:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R6210:Fmnl2 UTSW 2 53130445 missense possibly damaging 0.94
R6287:Fmnl2 UTSW 2 53014848 missense probably damaging 1.00
R6661:Fmnl2 UTSW 2 53108285 missense probably damaging 0.98
R6967:Fmnl2 UTSW 2 53097332 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATATGCCGCAATCCTCTTCG -3'
(R):5'- TGAACTCTGCTCATTTCTATGTCAG -3'

Sequencing Primer
(F):5'- CTCTTCGGGAGGATGTATTAAACTC -3'
(R):5'- ATTTCTATGTCAGACCCTTCCAC -3'
Posted On2015-10-08