Incidental Mutation 'R0268:Ap3m1'
ID35096
Institutional Source Beutler Lab
Gene Symbol Ap3m1
Ensembl Gene ENSMUSG00000021824
Gene Nameadaptor-related protein complex 3, mu 1 subunit
SynonymsC78982, 1200013D09Rik
MMRRC Submission 038494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0268 (G1)
Quality Score145
Status Validated
Chromosome14
Chromosomal Location21031442-21052508 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 21037102 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022369] [ENSMUST00000022371] [ENSMUST00000126536] [ENSMUST00000130291] [ENSMUST00000154460] [ENSMUST00000224016]
Predicted Effect probably benign
Transcript: ENSMUST00000022369
SMART Domains Protein: ENSMUSP00000022369
Gene: ENSMUSG00000021823

DomainStartEndE-ValueType
Pfam:Vinculin 3 485 9e-203 PFAM
Pfam:Vinculin 475 1066 1.7e-301 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022371
SMART Domains Protein: ENSMUSP00000022371
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 96 1e-23 SMART
Pfam:Adap_comp_sub 111 364 9.1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122974
Predicted Effect probably benign
Transcript: ENSMUST00000126536
SMART Domains Protein: ENSMUSP00000116046
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 91 9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130291
SMART Domains Protein: ENSMUSP00000118259
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 138 9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148886
Predicted Effect probably benign
Transcript: ENSMUST00000154460
SMART Domains Protein: ENSMUSP00000117346
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 136 1.8e-8 PFAM
Pfam:Adap_comp_sub 165 418 1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156716
Predicted Effect probably benign
Transcript: ENSMUST00000224016
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 95.9%
  • 20x: 93.0%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the medium subunit of AP-3, which is an adaptor-related protein complex associated with the Golgi region as well as more peripheral intracellular structures. AP-3 facilitates the budding of vesicles from the Golgi membrane, and it may directly function in protein sorting to the endosomal/lysosomal system. AP-3 is a heterotetrameric protein complex composed of two large subunits (delta and beta3), a medium subunit (mu3), and a small subunit (sigma 3). Mutations in one of the large subunits of AP-3 have been associated with the Hermansky-Pudlak syndrome, a genetic disorder characterized by defective lysosome-related organelles. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,602 noncoding transcript Het
5430419D17Rik A G 7: 131,238,176 D609G probably damaging Het
Aadacl4 A T 4: 144,622,995 H274L probably benign Het
Aldh1a7 T A 19: 20,709,502 probably null Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Avpr1a T C 10: 122,449,709 V302A probably damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Cd209e T C 8: 3,849,125 I196V probably benign Het
Cdc42bpa G T 1: 180,155,782 probably benign Het
Clec16a T A 16: 10,644,828 L670* probably null Het
Cmtm2b A G 8: 104,322,434 E27G probably damaging Het
Col4a1 T A 8: 11,267,588 probably benign Het
Cyp26b1 A T 6: 84,574,572 F221I probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Dip2c G A 13: 9,637,150 R1270H probably damaging Het
Dlg1 T C 16: 31,684,193 C73R probably benign Het
Dnah8 A G 17: 30,769,707 D3217G probably damaging Het
Dtx1 T C 5: 120,681,291 E614G probably damaging Het
Dut C A 2: 125,257,091 A166E probably damaging Het
Ebf1 C A 11: 44,643,413 D166E probably damaging Het
Egln2 A T 7: 27,165,247 D84E possibly damaging Het
Exosc7 T A 9: 123,118,960 S65T probably benign Het
Fam83e G A 7: 45,726,910 R349Q probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fras1 A G 5: 96,737,009 N2582S probably damaging Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gls GGCTGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTGCTG 1: 52,232,694 probably benign Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Hcn4 A C 9: 58,860,162 E1002A unknown Het
Hcrtr2 A G 9: 76,228,188 V449A probably benign Het
Hectd1 C A 12: 51,769,107 S1394I probably damaging Het
Hectd1 T C 12: 51,769,108 S1394G possibly damaging Het
Hecw2 A G 1: 53,926,698 probably benign Het
Herc3 A G 6: 58,868,628 probably benign Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itsn2 G A 12: 4,700,333 R1199Q probably benign Het
Kcnj3 C A 2: 55,594,959 Y356* probably null Het
Klb T A 5: 65,348,837 D142E probably benign Het
Klhl35 T A 7: 99,471,751 S409T probably benign Het
Krt16 T A 11: 100,246,525 probably benign Het
Krt82 C A 15: 101,541,713 R516L probably benign Het
Lce3a A T 3: 92,925,731 C21S unknown Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Map2 A T 1: 66,380,722 K71* probably null Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Mycbp2 T A 14: 103,314,325 R157* probably null Het
Nat10 C A 2: 103,727,917 probably benign Het
Obscn G A 11: 59,067,272 T3810M possibly damaging Het
Olfr1161 A T 2: 88,025,468 I249F probably damaging Het
Olfr1354 C T 10: 78,917,605 T255I probably damaging Het
Olfr1375 T A 11: 51,048,941 M278K probably damaging Het
Olfr525 G A 7: 140,323,155 S152N possibly damaging Het
Olfr799 A T 10: 129,647,176 D16V possibly damaging Het
Olfr998 A G 2: 85,591,301 T254A possibly damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Pgm1 T A 5: 64,105,808 V266E probably damaging Het
Phip G A 9: 82,871,288 T1801I probably damaging Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Ppp1r12a T A 10: 108,273,381 probably benign Het
Ppp1r32 A G 19: 10,477,085 V329A possibly damaging Het
Ptprq A T 10: 107,705,548 D372E probably benign Het
Ptprr G A 10: 116,252,963 V340I possibly damaging Het
Qk A G 17: 10,209,646 probably benign Het
Qpct T A 17: 79,077,652 D240E probably benign Het
Ren1 A G 1: 133,355,611 T162A possibly damaging Het
Rif1 T C 2: 52,090,286 probably null Het
Sart3 A G 5: 113,752,399 V461A probably damaging Het
Scgb1b24 G A 7: 33,743,853 G19R probably null Het
Spen A T 4: 141,477,557 I1253N unknown Het
Sspo C A 6: 48,465,555 H1995N probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Togaram2 T C 17: 71,697,998 probably null Het
Trim65 T A 11: 116,126,644 probably benign Het
Trpm3 T A 19: 22,897,521 probably null Het
Ubxn7 T C 16: 32,360,046 I87T probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r102 A G 17: 19,677,850 T376A probably benign Het
Vmn2r105 A T 17: 20,208,676 C713S probably benign Het
Zbtb45 C T 7: 13,008,327 M1I probably null Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Zfp932 T C 5: 110,009,063 I176T probably benign Het
Zswim1 G A 2: 164,826,126 E433K probably damaging Het
Other mutations in Ap3m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02628:Ap3m1 APN 14 21045520 nonsense probably null
IGL02815:Ap3m1 APN 14 21036682 missense probably damaging 1.00
R1780:Ap3m1 UTSW 14 21041070 missense probably benign 0.20
R1961:Ap3m1 UTSW 14 21041015 missense probably damaging 1.00
R2029:Ap3m1 UTSW 14 21039149 missense possibly damaging 0.94
R3903:Ap3m1 UTSW 14 21036664 missense probably null 1.00
R4837:Ap3m1 UTSW 14 21037157 missense probably damaging 1.00
R4952:Ap3m1 UTSW 14 21040066 missense probably benign 0.00
R5050:Ap3m1 UTSW 14 21044775 missense probably benign 0.00
R5741:Ap3m1 UTSW 14 21045720 missense possibly damaging 0.95
R6761:Ap3m1 UTSW 14 21038028 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACTGCACAGTGCTCCATTCATC -3'
(R):5'- GCATCTGTTGACCTCTGAGCATGTC -3'

Sequencing Primer
(F):5'- CTGTACTCTAAGGAGCATGGC -3'
(R):5'- GCATGTCTTTAACACAGCTCAGG -3'
Posted On2013-05-09