Incidental Mutation 'R3981:Cacnb2'
ID351144
Institutional Source Beutler Lab
Gene Symbol Cacnb2
Ensembl Gene ENSMUSG00000057914
Gene Namecalcium channel, voltage-dependent, beta 2 subunit
SynonymsCchb2, Cavbeta2
MMRRC Submission 040943-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3981 (G1)
Quality Score128
Status Validated
Chromosome2
Chromosomal Location14603088-14987908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14604503 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 18 (E18G)
Ref Sequence ENSEMBL: ENSMUSP00000110371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114723]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100397
Predicted Effect probably benign
Transcript: ENSMUST00000114723
AA Change: E18G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110371
Gene: ENSMUSG00000057914
AA Change: E18G

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 68 109 2.7e-25 PFAM
SH3 113 177 2.42e-2 SMART
low complexity region 193 205 N/A INTRINSIC
GuKc 276 458 6.11e-38 SMART
low complexity region 463 492 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193730
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality at E10.5 with growth retardation, abnormal yolk vasculature and abnormal cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,971,534 T289I probably damaging Het
Abca13 T G 11: 9,532,407 C4313G probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bhlhe22 G T 3: 18,054,894 R36L probably damaging Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cep295 G T 9: 15,317,067 probably benign Het
Cep89 A G 7: 35,438,383 R731G probably damaging Het
Chrnb3 C T 8: 27,394,006 T257M probably damaging Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Clca4b T C 3: 144,926,036 K236R probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cry1 A T 10: 85,146,592 Y297N probably damaging Het
Defb38 A G 8: 19,026,467 probably null Het
Dlgap1 A G 17: 70,516,785 K255R probably damaging Het
Erich6 T C 3: 58,636,704 E154G probably benign Het
Esf1 G A 2: 140,158,556 P437S probably benign Het
Fkbp7 A C 2: 76,663,257 N197K probably damaging Het
Fsip2 T A 2: 82,958,662 D342E probably benign Het
Gbx1 T C 5: 24,526,215 D201G probably benign Het
Gm15056 T A 8: 20,900,941 K25N possibly damaging Het
Grb7 T G 11: 98,454,565 probably benign Het
H2-M3 C T 17: 37,271,130 A159V probably damaging Het
Hcar1 T C 5: 123,878,620 N336S probably benign Het
Ift122 T C 6: 115,913,921 V807A probably benign Het
Maml2 T C 9: 13,621,068 V526A possibly damaging Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Mras T C 9: 99,411,416 D57G probably damaging Het
Muc5ac T C 7: 141,813,775 C2274R possibly damaging Het
Olfr1062 T A 2: 86,422,842 Y278F probably damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Ros1 G A 10: 52,120,878 H1233Y possibly damaging Het
Samd8 A G 14: 21,780,180 R225G probably null Het
Slc7a11 C A 3: 50,427,774 V175L probably benign Het
Spata31d1c A G 13: 65,035,111 T156A possibly damaging Het
Stxbp5 T C 10: 9,789,316 probably benign Het
Tec T A 5: 72,823,599 probably benign Het
Tex37 T C 6: 70,913,299 N170D possibly damaging Het
Vps16 T C 2: 130,442,594 W728R possibly damaging Het
Xirp1 T C 9: 120,017,744 E691G probably damaging Het
Zfp605 T C 5: 110,127,738 S241P probably damaging Het
Zfp839 G A 12: 110,866,331 G561D probably damaging Het
Other mutations in Cacnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cacnb2 APN 2 14984270 missense possibly damaging 0.95
IGL01806:Cacnb2 APN 2 14614268 missense probably damaging 1.00
IGL01939:Cacnb2 APN 2 14971569 missense probably benign 0.16
IGL02941:Cacnb2 APN 2 14958829 missense probably benign 0.00
PIT1430001:Cacnb2 UTSW 2 14971601 nonsense probably null
PIT4498001:Cacnb2 UTSW 2 14874819 nonsense probably null
PIT4508001:Cacnb2 UTSW 2 14984419 missense probably benign 0.00
R0095:Cacnb2 UTSW 2 14958775 missense probably damaging 1.00
R0731:Cacnb2 UTSW 2 14985706 missense possibly damaging 0.95
R1521:Cacnb2 UTSW 2 14614352 missense probably benign 0.18
R1829:Cacnb2 UTSW 2 14985964 missense possibly damaging 0.89
R2174:Cacnb2 UTSW 2 14958767 missense probably benign 0.21
R2471:Cacnb2 UTSW 2 14984314 missense probably damaging 1.00
R2473:Cacnb2 UTSW 2 14984314 missense probably damaging 1.00
R3801:Cacnb2 UTSW 2 14824263 missense possibly damaging 0.85
R3831:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3832:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3833:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R4231:Cacnb2 UTSW 2 14981440 missense probably damaging 1.00
R4426:Cacnb2 UTSW 2 14975215 nonsense probably null
R4569:Cacnb2 UTSW 2 14986000 missense possibly damaging 0.94
R4815:Cacnb2 UTSW 2 14874780 missense probably damaging 1.00
R4911:Cacnb2 UTSW 2 14981340 missense possibly damaging 0.83
R5189:Cacnb2 UTSW 2 14986038 missense possibly damaging 0.56
R6114:Cacnb2 UTSW 2 14975201 missense possibly damaging 0.88
R6158:Cacnb2 UTSW 2 14985601 missense possibly damaging 0.62
R6530:Cacnb2 UTSW 2 14975167 missense probably damaging 1.00
R6612:Cacnb2 UTSW 2 14975149 missense probably benign 0.41
R6882:Cacnb2 UTSW 2 14824299 missense probably benign 0.00
R6889:Cacnb2 UTSW 2 14986015 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTTGCAACATGCTTCAGCGG -3'
(R):5'- TCCCACTGGCTTTTCAGAAAG -3'

Sequencing Primer
(F):5'- ATGCTTCAGCGGCGTCG -3'
(R):5'- CTTTTCAGAAAGCAAAGGGGGC -3'
Posted On2015-10-08