Incidental Mutation 'R3981:Mfap2'
ID351158
Institutional Source Beutler Lab
Gene Symbol Mfap2
Ensembl Gene ENSMUSG00000060572
Gene Namemicrofibrillar-associated protein 2
SynonymsMagp
MMRRC Submission 040943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R3981 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141010418-141015984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141014243 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 71 (Q71R)
Ref Sequence ENSEMBL: ENSMUSP00000132711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000071977] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000166376] [ENSMUST00000168157]
Predicted Effect probably benign
Transcript: ENSMUST00000040222
SMART Domains Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000071977
AA Change: Q71R

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071868
Gene: ENSMUSG00000060572
AA Change: Q71R

DomainStartEndE-ValueType
Pfam:MAGP 3 153 1.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097816
SMART Domains Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102491
SMART Domains Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
Pfam:Rootletin 158 336 9.7e-65 PFAM
low complexity region 354 381 N/A INTRINSIC
internal_repeat_2 462 479 1.77e-6 PROSPERO
low complexity region 493 514 N/A INTRINSIC
internal_repeat_3 527 557 8.63e-6 PROSPERO
internal_repeat_6 533 556 4.21e-5 PROSPERO
low complexity region 561 575 N/A INTRINSIC
low complexity region 576 594 N/A INTRINSIC
low complexity region 617 638 N/A INTRINSIC
low complexity region 788 807 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 1009 1039 N/A INTRINSIC
internal_repeat_4 1050 1068 4.21e-5 PROSPERO
internal_repeat_7 1057 1070 9.31e-5 PROSPERO
internal_repeat_2 1057 1074 1.77e-6 PROSPERO
internal_repeat_4 1061 1078 4.21e-5 PROSPERO
internal_repeat_1 1076 1101 3.36e-8 PROSPERO
internal_repeat_7 1192 1205 9.31e-5 PROSPERO
low complexity region 1271 1288 N/A INTRINSIC
internal_repeat_5 1302 1328 4.21e-5 PROSPERO
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1434 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
internal_repeat_6 1697 1720 4.21e-5 PROSPERO
low complexity region 1723 1740 N/A INTRINSIC
coiled coil region 1744 1871 N/A INTRINSIC
coiled coil region 1892 1996 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151455
Predicted Effect possibly damaging
Transcript: ENSMUST00000166376
AA Change: Q71R

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132711
Gene: ENSMUSG00000060572
AA Change: Q71R

DomainStartEndE-ValueType
Pfam:MAGP 2 153 2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168157
SMART Domains Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microfibrillar-associated protein 2 is a major antigen of elastin-associated microfibrils and a candidate for involvement in the etiology of inherited connective tissue diseases. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygotes for a knock-out allele show thrombocytopenia, delayed thrombotic occlusion following vessel injury, and prolonged bleeding from a tail vein incision. Homozygotes for a different knock-out allele exhibit marrow adipose tissue expansion, insulin resistance, and altered basal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,971,534 T289I probably damaging Het
Abca13 T G 11: 9,532,407 C4313G probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bhlhe22 G T 3: 18,054,894 R36L probably damaging Het
Cacnb2 A G 2: 14,604,503 E18G probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cep295 G T 9: 15,317,067 probably benign Het
Cep89 A G 7: 35,438,383 R731G probably damaging Het
Chrnb3 C T 8: 27,394,006 T257M probably damaging Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Clca4b T C 3: 144,926,036 K236R probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cry1 A T 10: 85,146,592 Y297N probably damaging Het
Defb38 A G 8: 19,026,467 probably null Het
Dlgap1 A G 17: 70,516,785 K255R probably damaging Het
Erich6 T C 3: 58,636,704 E154G probably benign Het
Esf1 G A 2: 140,158,556 P437S probably benign Het
Fkbp7 A C 2: 76,663,257 N197K probably damaging Het
Fsip2 T A 2: 82,958,662 D342E probably benign Het
Gbx1 T C 5: 24,526,215 D201G probably benign Het
Gm15056 T A 8: 20,900,941 K25N possibly damaging Het
Grb7 T G 11: 98,454,565 probably benign Het
H2-M3 C T 17: 37,271,130 A159V probably damaging Het
Hcar1 T C 5: 123,878,620 N336S probably benign Het
Ift122 T C 6: 115,913,921 V807A probably benign Het
Maml2 T C 9: 13,621,068 V526A possibly damaging Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Mras T C 9: 99,411,416 D57G probably damaging Het
Muc5ac T C 7: 141,813,775 C2274R possibly damaging Het
Olfr1062 T A 2: 86,422,842 Y278F probably damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Ros1 G A 10: 52,120,878 H1233Y possibly damaging Het
Samd8 A G 14: 21,780,180 R225G probably null Het
Slc7a11 C A 3: 50,427,774 V175L probably benign Het
Spata31d1c A G 13: 65,035,111 T156A possibly damaging Het
Stxbp5 T C 10: 9,789,316 probably benign Het
Tec T A 5: 72,823,599 probably benign Het
Tex37 T C 6: 70,913,299 N170D possibly damaging Het
Vps16 T C 2: 130,442,594 W728R possibly damaging Het
Xirp1 T C 9: 120,017,744 E691G probably damaging Het
Zfp605 T C 5: 110,127,738 S241P probably damaging Het
Zfp839 G A 12: 110,866,331 G561D probably damaging Het
Other mutations in Mfap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Mfap2 APN 4 141015545 missense possibly damaging 0.82
IGL02422:Mfap2 APN 4 141014224 missense probably benign 0.02
R0149:Mfap2 UTSW 4 141014983 missense probably damaging 1.00
R0361:Mfap2 UTSW 4 141014983 missense probably damaging 1.00
R0545:Mfap2 UTSW 4 141014185 unclassified probably benign
R3983:Mfap2 UTSW 4 141014243 missense possibly damaging 0.80
R4993:Mfap2 UTSW 4 141015578 makesense probably null
R5019:Mfap2 UTSW 4 141015258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGACTACTATGACTACCAAGG -3'
(R):5'- TTTCTCCAGCTTACCAAGAGGG -3'

Sequencing Primer
(F):5'- CTATGACTACCAAGGTAAAAGTCTGG -3'
(R):5'- TAGGCTCAGTCTCCAGGTC -3'
Posted On2015-10-08