Incidental Mutation 'R4650:Nmi'
ID351199
Institutional Source Beutler Lab
Gene Symbol Nmi
Ensembl Gene ENSMUSG00000026946
Gene NameN-myc (and STAT) interactor
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R4650 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location51948487-51973494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 51948634 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 296 (C296F)
Ref Sequence ENSEMBL: ENSMUSP00000120647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028314] [ENSMUST00000112705] [ENSMUST00000142868] [ENSMUST00000145481]
Predicted Effect probably benign
Transcript: ENSMUST00000028314
AA Change: C296F

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028314
Gene: ENSMUSG00000026946
AA Change: C296F

DomainStartEndE-ValueType
Pfam:IFP_35_N 30 105 7.6e-39 PFAM
Pfam:NID 106 193 3.7e-49 PFAM
Pfam:NID 204 292 1.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112705
AA Change: C296F

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108325
Gene: ENSMUSG00000026946
AA Change: C296F

DomainStartEndE-ValueType
Pfam:IFP_35_N 30 105 7.6e-39 PFAM
Pfam:NID 106 193 3.7e-49 PFAM
Pfam:NID 204 292 1.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142868
SMART Domains Protein: ENSMUSP00000115428
Gene: ENSMUSG00000026946

DomainStartEndE-ValueType
Pfam:NID 1 26 3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145481
AA Change: C296F

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120647
Gene: ENSMUSG00000026946
AA Change: C296F

DomainStartEndE-ValueType
Pfam:IFP_35_N 30 105 3.7e-41 PFAM
Pfam:NID 106 193 7.3e-34 PFAM
Pfam:NID 204 292 2.9e-33 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NMYC interactor (NMI) encodes a protein that interacts with NMYC and CMYC (two members of the oncogene Myc family), and other transcription factors containing a Zip, HLH, or HLH-Zip motif. The NMI protein also interacts with all STATs except STAT2 and augments STAT-mediated transcription in response to cytokines IL2 and IFN-gamma. The NMI mRNA has low expression levels in all human fetal and adult tissues tested except brain and has high expression in cancer cell line-myeloid leukemias. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T A 16: 89,063,715 Y77F unknown Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Aldoa A G 7: 126,797,707 S71P possibly damaging Het
Arhgef12 A G 9: 42,981,970 V979A probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Brd8 T C 18: 34,606,699 T674A probably benign Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Capza1 A G 3: 104,844,980 V14A probably damaging Het
Cdk2 A T 10: 128,702,495 I135N probably damaging Het
Celf4 A T 18: 25,496,245 M407K possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Cideb A G 14: 55,755,231 V76A possibly damaging Het
Dbpht2 C G 12: 74,299,159 noncoding transcript Het
Dis3l2 A G 1: 86,990,321 D550G possibly damaging Het
Dnah1 A T 14: 31,284,887 probably null Het
Edc4 T A 8: 105,892,675 L1293* probably null Het
Elp5 A G 11: 69,969,572 V203A possibly damaging Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Gjb3 T C 4: 127,326,691 Y16C probably damaging Het
Gm5773 A G 3: 93,773,405 D128G probably benign Het
Gnb1l T C 16: 18,544,275 probably null Het
Gon4l G A 3: 88,863,552 D514N possibly damaging Het
Grhl3 T A 4: 135,549,236 probably null Het
Hoxc10 T C 15: 102,967,263 S136P probably benign Het
Ift22 G A 5: 136,911,801 V107I probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lgi4 G A 7: 31,069,129 A518T probably benign Het
Lhx2 T A 2: 38,360,040 N290K probably damaging Het
Ltbp4 A T 7: 27,314,309 C1092S probably damaging Het
Macf1 T C 4: 123,473,619 I2450V probably benign Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Myb A G 10: 21,152,941 L86P probably damaging Het
Myh3 C T 11: 67,086,444 T333M probably damaging Het
Nek11 T C 9: 105,348,080 N78D possibly damaging Het
Nphs1 A T 7: 30,482,470 T1163S probably benign Het
Npy4r C T 14: 34,146,224 G369D possibly damaging Het
Ola1 T C 2: 73,141,965 T221A probably damaging Het
Olfr251 T C 9: 38,378,403 F168S probably damaging Het
Olfr557 A G 7: 102,698,820 D194G probably damaging Het
Pfkfb2 A T 1: 130,705,463 N184K possibly damaging Het
Plce1 T C 19: 38,524,644 V129A probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pth A T 7: 113,385,819 *116K probably null Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rwdd3 A G 3: 121,159,177 F55S probably damaging Het
Serpinb9d A T 13: 33,202,853 L301F probably benign Het
Slc35e4 A G 11: 3,912,677 C171R probably damaging Het
Slco1a4 A T 6: 141,812,698 I529K possibly damaging Het
Styk1 A T 6: 131,300,569 W370R probably damaging Het
Tmprss11e C A 5: 86,727,353 W18L probably damaging Het
Trpv1 A C 11: 73,238,263 E2A probably benign Het
Unc13b T A 4: 43,261,035 I1799N probably damaging Het
Vmn1r213 G A 13: 23,012,252 C335Y possibly damaging Het
Vps37c C T 19: 10,712,909 S245L probably benign Het
Wrn T C 8: 33,255,509 T1191A probably benign Het
Zfp13 A G 17: 23,580,138 L153P probably damaging Het
Zfp472 T G 17: 32,977,657 S235R possibly damaging Het
Other mutations in Nmi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Nmi APN 2 51956040 unclassified probably null
IGL02041:Nmi APN 2 51960629 missense possibly damaging 0.72
IGL02299:Nmi APN 2 51958964 missense probably damaging 1.00
IGL03144:Nmi APN 2 51952534 missense probably damaging 1.00
R1589:Nmi UTSW 2 51958977 missense possibly damaging 0.62
R1961:Nmi UTSW 2 51948620 missense probably benign 0.01
R2114:Nmi UTSW 2 51948707 missense probably benign 0.30
R2115:Nmi UTSW 2 51948707 missense probably benign 0.30
R2116:Nmi UTSW 2 51948707 missense probably benign 0.30
R2151:Nmi UTSW 2 51952543 missense probably damaging 1.00
R2153:Nmi UTSW 2 51952543 missense probably damaging 1.00
R3964:Nmi UTSW 2 51956069 missense possibly damaging 0.85
R4195:Nmi UTSW 2 51948620 missense probably benign 0.00
R6573:Nmi UTSW 2 51950069 missense possibly damaging 0.55
R7129:Nmi UTSW 2 51955924 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTGTAAACACACAGCAGAGCTC -3'
(R):5'- GAACACATCCCTTCAGTTGCC -3'

Sequencing Primer
(F):5'- TGTTAAGAGTCAGGAATAGATTTTGC -3'
(R):5'- CCCTTCAGTTGCCATAATAATTTAGC -3'
Posted On2015-10-08