Incidental Mutation 'R4650:Gon4l'
ID351203
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R4650 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88863552 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 514 (D514N)
Ref Sequence ENSEMBL: ENSMUSP00000088461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081695
AA Change: D513N

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: D513N

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082804
Predicted Effect possibly damaging
Transcript: ENSMUST00000090942
AA Change: D514N

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: D514N

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107498
AA Change: D513N

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: D513N

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198251
Predicted Effect unknown
Transcript: ENSMUST00000212694
AA Change: D221N
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T A 16: 89,063,715 Y77F unknown Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Aldoa A G 7: 126,797,707 S71P possibly damaging Het
Arhgef12 A G 9: 42,981,970 V979A probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Brd8 T C 18: 34,606,699 T674A probably benign Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Capza1 A G 3: 104,844,980 V14A probably damaging Het
Cdk2 A T 10: 128,702,495 I135N probably damaging Het
Celf4 A T 18: 25,496,245 M407K possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Cideb A G 14: 55,755,231 V76A possibly damaging Het
Dbpht2 C G 12: 74,299,159 noncoding transcript Het
Dis3l2 A G 1: 86,990,321 D550G possibly damaging Het
Dnah1 A T 14: 31,284,887 probably null Het
Edc4 T A 8: 105,892,675 L1293* probably null Het
Elp5 A G 11: 69,969,572 V203A possibly damaging Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Gjb3 T C 4: 127,326,691 Y16C probably damaging Het
Gm5773 A G 3: 93,773,405 D128G probably benign Het
Gnb1l T C 16: 18,544,275 probably null Het
Grhl3 T A 4: 135,549,236 probably null Het
Hoxc10 T C 15: 102,967,263 S136P probably benign Het
Ift22 G A 5: 136,911,801 V107I probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lgi4 G A 7: 31,069,129 A518T probably benign Het
Lhx2 T A 2: 38,360,040 N290K probably damaging Het
Ltbp4 A T 7: 27,314,309 C1092S probably damaging Het
Macf1 T C 4: 123,473,619 I2450V probably benign Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Myb A G 10: 21,152,941 L86P probably damaging Het
Myh3 C T 11: 67,086,444 T333M probably damaging Het
Nek11 T C 9: 105,348,080 N78D possibly damaging Het
Nmi C A 2: 51,948,634 C296F probably benign Het
Nphs1 A T 7: 30,482,470 T1163S probably benign Het
Npy4r C T 14: 34,146,224 G369D possibly damaging Het
Ola1 T C 2: 73,141,965 T221A probably damaging Het
Olfr251 T C 9: 38,378,403 F168S probably damaging Het
Olfr557 A G 7: 102,698,820 D194G probably damaging Het
Pfkfb2 A T 1: 130,705,463 N184K possibly damaging Het
Plce1 T C 19: 38,524,644 V129A probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pth A T 7: 113,385,819 *116K probably null Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rwdd3 A G 3: 121,159,177 F55S probably damaging Het
Serpinb9d A T 13: 33,202,853 L301F probably benign Het
Slc35e4 A G 11: 3,912,677 C171R probably damaging Het
Slco1a4 A T 6: 141,812,698 I529K possibly damaging Het
Styk1 A T 6: 131,300,569 W370R probably damaging Het
Tmprss11e C A 5: 86,727,353 W18L probably damaging Het
Trpv1 A C 11: 73,238,263 E2A probably benign Het
Unc13b T A 4: 43,261,035 I1799N probably damaging Het
Vmn1r213 G A 13: 23,012,252 C335Y possibly damaging Het
Vps37c C T 19: 10,712,909 S245L probably benign Het
Wrn T C 8: 33,255,509 T1191A probably benign Het
Zfp13 A G 17: 23,580,138 L153P probably damaging Het
Zfp472 T G 17: 32,977,657 S235R possibly damaging Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 intron probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88895179 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATTATTTTCACATCCTGAATGCC -3'
(R):5'- TGGCAGACTTCTTATCCTGCTG -3'

Sequencing Primer
(F):5'- GAATGCCTTTTCCTTCTACATGC -3'
(R):5'- TGCTAAGCACATGTTCTAACCCTGAG -3'
Posted On2015-10-08