Incidental Mutation 'R4651:Pgm3'
ID351295
Institutional Source Beutler Lab
Gene Symbol Pgm3
Ensembl Gene ENSMUSG00000056131
Gene Namephosphoglucomutase 3
SynonymsPgm-3, GlcNAc-P mutase, 2810473H05Rik
MMRRC Submission 041911-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R4651 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location86554377-86571842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86558470 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 389 (R389S)
Ref Sequence ENSEMBL: ENSMUSP00000072390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000070064] [ENSMUST00000072585] [ENSMUST00000185919] [ENSMUST00000189817] [ENSMUST00000190957]
Predicted Effect probably benign
Transcript: ENSMUST00000034987
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070064
AA Change: R389S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070871
Gene: ENSMUSG00000056131
AA Change: R389S

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 44 102 6.5e-9 PFAM
Pfam:PGM_PMM_I 96 174 4.3e-9 PFAM
Pfam:PGM_PMM_IV 443 528 8.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072585
AA Change: R389S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072390
Gene: ENSMUSG00000056131
AA Change: R389S

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 44 102 2.5e-10 PFAM
Pfam:PGM_PMM_I 95 175 3.6e-11 PFAM
Pfam:PGM_PMM_II 181 291 9.4e-14 PFAM
SCOP:d3pmga3 298 374 1e-8 SMART
Pfam:PGM_PMM_IV 383 487 8.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185919
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189564
Predicted Effect probably benign
Transcript: ENSMUST00000189817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190924
Predicted Effect probably benign
Transcript: ENSMUST00000190957
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphohexose mutase family. The encoded protein mediates both glycogen formation and utilization by catalyzing the interconversion of glucose-1-phosphate and glucose-6-phosphate. A non-synonymous single nucleotide polymorphism in this gene may play a role in resistance to diabetic nephropathy and neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility, anemia, leukopenia, thrombocytopenia, abnormal pancreatic and salivary gland morphology, and splenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Ankrd26 T C 6: 118,515,826 D1319G probably benign Het
Ankrd35 T C 3: 96,684,027 V543A probably benign Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp5c1 A G 2: 10,063,476 F180S probably damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Ccnf C A 17: 24,231,786 R406L probably damaging Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Cpox G T 16: 58,670,687 R87L possibly damaging Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cux1 A T 5: 136,567,229 N4K probably damaging Het
Cyp3a25 T C 5: 145,994,891 T136A probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Ehmt2 C A 17: 34,913,814 N1171K probably damaging Het
Fanci T A 7: 79,435,256 M838K possibly damaging Het
Flot1 T C 17: 35,832,544 probably benign Het
Gad2 A T 2: 22,668,362 D364V probably damaging Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
Ip6k3 C T 17: 27,145,291 C261Y probably damaging Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kalrn G T 16: 34,176,391 P1477Q probably damaging Het
Kyat1 G T 2: 30,194,064 H15N probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Lsm2 T A 17: 34,985,595 probably benign Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Mettl3 T A 14: 52,295,092 I545F probably damaging Het
Naa20 CTCTAGA C 2: 145,911,832 probably benign Het
Ncapg2 T A 12: 116,425,787 N342K probably damaging Het
Ndufaf6 T A 4: 11,062,070 Y187F probably damaging Het
Nomo1 T A 7: 46,068,442 I799N probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr430 A G 1: 174,069,828 I177V possibly damaging Het
Olfr807 T C 10: 129,755,418 I11V probably benign Het
Olfr849 T A 9: 19,441,295 C127* probably null Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
Rrnad1 T C 3: 87,927,672 H107R probably benign Het
Sdr42e1 T C 8: 117,663,621 T94A probably benign Het
Setd2 A G 9: 110,594,132 D2085G possibly damaging Het
Sgce T C 6: 4,689,560 probably benign Het
Shisa3 A G 5: 67,608,649 D81G probably damaging Het
Sipa1l1 T A 12: 82,422,471 L1248* probably null Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc5a3 T A 16: 92,077,202 V49E probably benign Het
Slc9c1 A T 16: 45,547,393 *163L probably null Het
Smyd3 A G 1: 179,043,741 Y358H probably benign Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Syne2 A G 12: 75,989,239 T3767A probably damaging Het
Sytl2 C A 7: 90,375,425 P207Q probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Unc45a T C 7: 80,333,029 K383E possibly damaging Het
Usp7 A C 16: 8,698,414 probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Vrk2 T C 11: 26,489,803 D256G probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Wiz C T 17: 32,357,681 R624Q probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Pgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Pgm3 APN 9 86561879 missense probably damaging 0.96
IGL01865:Pgm3 APN 9 86555318 missense possibly damaging 0.85
IGL02800:Pgm3 APN 9 86555378 missense possibly damaging 0.94
R6592_Pgm3_648 UTSW 9 86559443 missense possibly damaging 0.87
R0038:Pgm3 UTSW 9 86564673 splice site probably benign
R0038:Pgm3 UTSW 9 86564673 splice site probably benign
R0266:Pgm3 UTSW 9 86567533 missense probably benign 0.00
R0536:Pgm3 UTSW 9 86567536 missense possibly damaging 0.83
R0617:Pgm3 UTSW 9 86556190 critical splice donor site probably null
R1499:Pgm3 UTSW 9 86570287 missense probably benign 0.01
R1780:Pgm3 UTSW 9 86556204 missense probably damaging 1.00
R1838:Pgm3 UTSW 9 86569233 missense probably benign 0.03
R1882:Pgm3 UTSW 9 86565690 missense possibly damaging 0.72
R1920:Pgm3 UTSW 9 86558478 missense possibly damaging 0.47
R2095:Pgm3 UTSW 9 86556341 missense probably damaging 0.99
R2378:Pgm3 UTSW 9 86562667 missense probably damaging 0.97
R2679:Pgm3 UTSW 9 86569321 missense probably benign 0.32
R3021:Pgm3 UTSW 9 86567535 missense possibly damaging 0.95
R3686:Pgm3 UTSW 9 86559510 missense probably benign 0.37
R4490:Pgm3 UTSW 9 86561840 missense probably damaging 1.00
R4652:Pgm3 UTSW 9 86558470 missense probably benign 0.01
R4718:Pgm3 UTSW 9 86570395 missense probably benign 0.00
R4883:Pgm3 UTSW 9 86569325 missense probably damaging 1.00
R4940:Pgm3 UTSW 9 86559476 missense probably damaging 1.00
R4973:Pgm3 UTSW 9 86562679 missense probably benign
R4990:Pgm3 UTSW 9 86558412 missense probably damaging 0.97
R5357:Pgm3 UTSW 9 86556257 nonsense probably null
R5870:Pgm3 UTSW 9 86570361 missense probably damaging 0.99
R6592:Pgm3 UTSW 9 86559443 missense possibly damaging 0.87
R6807:Pgm3 UTSW 9 86556502 intron probably null
R7152:Pgm3 UTSW 9 86567540 missense probably benign 0.13
R7274:Pgm3 UTSW 9 86562597 missense probably damaging 1.00
X0028:Pgm3 UTSW 9 86569355 missense probably damaging 1.00
Z1088:Pgm3 UTSW 9 86564707 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCTAAGTCTTAACAGTGGACAAC -3'
(R):5'- TCAAGATGTGCGTGGAGAAC -3'

Sequencing Primer
(F):5'- TGGACAACACAGTTAGAAACAAAC -3'
(R):5'- CACATGTCTTAGTTTTTGTCAAGCAG -3'
Posted On2015-10-08