Incidental Mutation 'R4651:Sipa1l1'
ID351316
Institutional Source Beutler Lab
Gene Symbol Sipa1l1
Ensembl Gene ENSMUSG00000042700
Gene Namesignal-induced proliferation-associated 1 like 1
Synonyms4931426N11Rik, Spar
MMRRC Submission 041911-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4651 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location82169320-82451786 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 82422471 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1248 (L1248*)
Ref Sequence ENSEMBL: ENSMUSP00000152212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053969] [ENSMUST00000166429] [ENSMUST00000220963] [ENSMUST00000222298] [ENSMUST00000222714]
Predicted Effect probably null
Transcript: ENSMUST00000053969
AA Change: L1248*
SMART Domains Protein: ENSMUSP00000061014
Gene: ENSMUSG00000042700
AA Change: L1248*

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 810 8.9e-70 PFAM
PDZ 962 1028 2.63e-9 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:SPAR_C 1483 1727 4.4e-86 PFAM
low complexity region 1731 1746 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166429
AA Change: L1248*
SMART Domains Protein: ENSMUSP00000131030
Gene: ENSMUSG00000042700
AA Change: L1248*

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 816 1.3e-64 PFAM
PDZ 962 1028 1.3e-11 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:DUF3401 1483 1727 1.8e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000220963
AA Change: L1248*
Predicted Effect probably null
Transcript: ENSMUST00000221169
AA Change: L48*
Predicted Effect probably null
Transcript: ENSMUST00000222298
AA Change: L1248*
Predicted Effect probably null
Transcript: ENSMUST00000222714
AA Change: L1248*
Meta Mutation Damage Score 0.54 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (98/101)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Ankrd26 T C 6: 118,515,826 D1319G probably benign Het
Ankrd35 T C 3: 96,684,027 V543A probably benign Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp5c1 A G 2: 10,063,476 F180S probably damaging Het
Btnl4 A G 17: 34,472,628 S296P probably benign Het
Cast A G 13: 74,746,014 S171P probably benign Het
Catsperb G A 12: 101,541,512 A513T probably benign Het
Ccnf C A 17: 24,231,786 R406L probably damaging Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Cpox G T 16: 58,670,687 R87L possibly damaging Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cux1 A T 5: 136,567,229 N4K probably damaging Het
Cyp3a25 T C 5: 145,994,891 T136A probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Ehmt2 C A 17: 34,913,814 N1171K probably damaging Het
Fanci T A 7: 79,435,256 M838K possibly damaging Het
Flot1 T C 17: 35,832,544 probably benign Het
Gad2 A T 2: 22,668,362 D364V probably damaging Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
Ip6k3 C T 17: 27,145,291 C261Y probably damaging Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kalrn G T 16: 34,176,391 P1477Q probably damaging Het
Kyat1 G T 2: 30,194,064 H15N probably benign Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Lsm2 T A 17: 34,985,595 probably benign Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Mettl3 T A 14: 52,295,092 I545F probably damaging Het
Naa20 CTCTAGA C 2: 145,911,832 probably benign Het
Ncapg2 T A 12: 116,425,787 N342K probably damaging Het
Ndufaf6 T A 4: 11,062,070 Y187F probably damaging Het
Nomo1 T A 7: 46,068,442 I799N probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr430 A G 1: 174,069,828 I177V possibly damaging Het
Olfr807 T C 10: 129,755,418 I11V probably benign Het
Olfr849 T A 9: 19,441,295 C127* probably null Het
Pgm3 T A 9: 86,558,470 R389S probably benign Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
Rrnad1 T C 3: 87,927,672 H107R probably benign Het
Sdr42e1 T C 8: 117,663,621 T94A probably benign Het
Setd2 A G 9: 110,594,132 D2085G possibly damaging Het
Sgce T C 6: 4,689,560 probably benign Het
Shisa3 A G 5: 67,608,649 D81G probably damaging Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc5a3 T A 16: 92,077,202 V49E probably benign Het
Slc9c1 A T 16: 45,547,393 *163L probably null Het
Smyd3 A G 1: 179,043,741 Y358H probably benign Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Syne2 A G 12: 75,989,239 T3767A probably damaging Het
Sytl2 C A 7: 90,375,425 P207Q probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Unc45a T C 7: 80,333,029 K383E possibly damaging Het
Usp7 A C 16: 8,698,414 probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Vrk2 T C 11: 26,489,803 D256G probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Wiz C T 17: 32,357,681 R624Q probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Sipa1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Sipa1l1 APN 12 82387696 missense probably benign 0.06
IGL01478:Sipa1l1 APN 12 82446898 missense probably benign 0.00
IGL01620:Sipa1l1 APN 12 82422489 missense probably damaging 0.97
IGL02496:Sipa1l1 APN 12 82425094 missense probably damaging 1.00
IGL02550:Sipa1l1 APN 12 82440949 nonsense probably null
IGL02689:Sipa1l1 APN 12 82440820 missense probably benign 0.01
IGL02706:Sipa1l1 APN 12 82397433 missense possibly damaging 0.95
IGL02995:Sipa1l1 APN 12 82357331 missense probably benign 0.39
IGL03104:Sipa1l1 APN 12 82342130 missense probably benign 0.05
IGL03295:Sipa1l1 APN 12 82432940 missense probably damaging 1.00
bullae UTSW 12 82342250 missense probably damaging 1.00
bullish UTSW 12 82422471 nonsense probably null
ebullient UTSW 12 82341672 missense probably benign 0.18
PIT4431001:Sipa1l1 UTSW 12 82396516 missense probably benign 0.34
R0140:Sipa1l1 UTSW 12 82396200 missense probably damaging 1.00
R0348:Sipa1l1 UTSW 12 82384756 critical splice donor site probably null
R0534:Sipa1l1 UTSW 12 82425280 missense possibly damaging 0.94
R0538:Sipa1l1 UTSW 12 82425099 missense probably benign 0.00
R0547:Sipa1l1 UTSW 12 82437736 missense probably benign
R0980:Sipa1l1 UTSW 12 82342220 missense possibly damaging 0.60
R1051:Sipa1l1 UTSW 12 82449345 missense possibly damaging 0.48
R1244:Sipa1l1 UTSW 12 82425416 missense probably benign 0.00
R1473:Sipa1l1 UTSW 12 82341111 missense probably damaging 1.00
R1508:Sipa1l1 UTSW 12 82440893 missense probably damaging 1.00
R1563:Sipa1l1 UTSW 12 82341161 missense probably benign 0.31
R1671:Sipa1l1 UTSW 12 82397461 missense probably damaging 1.00
R1935:Sipa1l1 UTSW 12 82372434 missense probably damaging 1.00
R1950:Sipa1l1 UTSW 12 82341459 missense probably damaging 0.98
R2191:Sipa1l1 UTSW 12 82396691 nonsense probably null
R2249:Sipa1l1 UTSW 12 82342116 missense probably benign
R2909:Sipa1l1 UTSW 12 82357331 missense probably benign 0.39
R4012:Sipa1l1 UTSW 12 82341782 missense possibly damaging 0.86
R4154:Sipa1l1 UTSW 12 82425214 missense possibly damaging 0.95
R4382:Sipa1l1 UTSW 12 82446822 missense possibly damaging 0.46
R4448:Sipa1l1 UTSW 12 82341750 missense probably benign 0.15
R4652:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4751:Sipa1l1 UTSW 12 82341194 missense probably benign
R4755:Sipa1l1 UTSW 12 82372386 missense possibly damaging 0.74
R4888:Sipa1l1 UTSW 12 82342333 missense probably damaging 0.96
R4912:Sipa1l1 UTSW 12 82396678 missense possibly damaging 0.89
R4937:Sipa1l1 UTSW 12 82341329 missense probably benign 0.01
R5068:Sipa1l1 UTSW 12 82437827 missense probably damaging 1.00
R5113:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5114:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5240:Sipa1l1 UTSW 12 82341588 missense possibly damaging 0.92
R6041:Sipa1l1 UTSW 12 82342250 missense probably damaging 1.00
R6048:Sipa1l1 UTSW 12 82440869 missense probably benign 0.03
R6170:Sipa1l1 UTSW 12 82341672 missense probably benign 0.18
R6185:Sipa1l1 UTSW 12 82425028 missense probably damaging 1.00
R6326:Sipa1l1 UTSW 12 82372468 missense probably damaging 1.00
R6842:Sipa1l1 UTSW 12 82420546 missense probably benign 0.00
R7008:Sipa1l1 UTSW 12 82363112 missense probably damaging 0.99
R7058:Sipa1l1 UTSW 12 82403122 missense probably benign 0.00
R7069:Sipa1l1 UTSW 12 82341406 missense probably damaging 0.99
R7122:Sipa1l1 UTSW 12 82422462 missense possibly damaging 0.79
R7310:Sipa1l1 UTSW 12 82372495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCGCAGTAAGCTCTTAGAG -3'
(R):5'- GTGCCTCTTCTGCGTTAGAGAG -3'

Sequencing Primer
(F):5'- TGCGCAGTAAGCTCTTAGAGATATG -3'
(R):5'- GCCTCTTCTGCGTTAGAGAGAATAAG -3'
Posted On2015-10-08