Incidental Mutation 'R4652:Dyrk1a'
ID351434
Institutional Source Beutler Lab
Gene Symbol Dyrk1a
Ensembl Gene ENSMUSG00000022897
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a
SynonymsD16Ertd493e, Mnbh, 2310043O08Rik, D16Ertd272e, Dyrk
MMRRC Submission 041912-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4652 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location94570010-94695517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94692065 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 719 (T719I)
Ref Sequence ENSEMBL: ENSMUSP00000113660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023614] [ENSMUST00000119878] [ENSMUST00000122284]
Predicted Effect probably benign
Transcript: ENSMUST00000023614
AA Change: T719I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023614
Gene: ENSMUSG00000022897
AA Change: T719I

DomainStartEndE-ValueType
low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119878
AA Change: T719I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113660
Gene: ENSMUSG00000022897
AA Change: T719I

DomainStartEndE-ValueType
low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122284
AA Change: T681I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112853
Gene: ENSMUSG00000022897
AA Change: T681I

DomainStartEndE-ValueType
low complexity region 127 138 N/A INTRINSIC
S_TKc 150 470 6.63e-79 SMART
low complexity region 493 516 N/A INTRINSIC
low complexity region 590 611 N/A INTRINSIC
low complexity region 641 663 N/A INTRINSIC
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (111/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family. This member contains a nuclear targeting signal sequence, a protein kinase domain, a leucine zipper motif, and a highly conservative 13-consecutive-histidine repeat. It catalyzes its autophosphorylation on serine/threonine and tyrosine residues. It may play a significant role in a signaling pathway regulating cell proliferation and may be involved in brain development. This gene is a homolog of Drosophila mnb (minibrain) gene and rat Dyrk gene. It is localized in the Down syndrome critical region of chromosome 21, and is considered to be a strong candidate gene for learning defects associated with Down syndrome. Alternative splicing of this gene generates several transcript variants differing from each other either in the 5' UTR or in the 3' coding region. These variants encode at least five different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted deletion present a general embryonic growth delay and die during midgestation. Heterozygotes display reduced postnatal survival, postnatal growth retardation, microcephaly, behavioral and motor deficits, and altered neocortical pyramidal cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T A 8: 124,639,611 Q131L probably damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
A830018L16Rik C A 1: 11,537,342 probably benign Het
Adam26b A G 8: 43,521,338 V209A possibly damaging Het
Adh6a T A 3: 138,326,115 M256K probably benign Het
Ahnak2 T G 12: 112,774,837 S128R possibly damaging Het
Angptl2 G T 2: 33,243,883 D406Y probably damaging Het
Ano10 A T 9: 122,261,115 Y377* probably null Het
Arfgef1 C T 1: 10,173,262 D1021N probably damaging Het
Arhgap17 G A 7: 123,286,618 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10b G A 11: 43,194,645 G284S probably damaging Het
Atp13a4 A T 16: 29,452,603 D498E probably damaging Het
C4a T A 17: 34,810,131 noncoding transcript Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Camsap3 A C 8: 3,600,689 K223T possibly damaging Het
Cast A G 13: 74,746,014 S171P probably benign Het
Cdh8 T A 8: 99,024,859 D742V probably benign Het
Ceacam12 A G 7: 18,067,434 T113A probably damaging Het
Cers3 G A 7: 66,781,856 probably null Het
Cipc T C 12: 86,962,090 V241A probably benign Het
Cntn5 C A 9: 9,704,912 K832N possibly damaging Het
Col12a1 A T 9: 79,612,946 D2815E probably damaging Het
Ctf2 T C 7: 127,719,384 T148A probably benign Het
Cttnbp2 A G 6: 18,434,038 I607T possibly damaging Het
Cux1 A T 5: 136,567,229 N4K probably damaging Het
Dhx36 A T 3: 62,500,998 L140M probably benign Het
Dhx58 T A 11: 100,701,359 N288Y probably damaging Het
Dlgap1 T A 17: 70,761,095 Y554N probably damaging Het
Dnah10 T C 5: 124,729,143 Y127H probably benign Het
Dnah6 T C 6: 73,070,597 M3140V probably benign Het
Dnd1 G A 18: 36,765,061 probably benign Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Erlin1 T A 19: 44,040,792 K234* probably null Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Frmd4b T C 6: 97,295,755 H846R probably benign Het
Gm10375 C A 14: 43,606,869 probably null Het
Gm27047 T C 6: 130,630,516 noncoding transcript Het
Gm7168 A G 17: 13,949,807 R479G possibly damaging Het
Gm9996 T A 10: 29,143,758 probably benign Het
Gnat3 T A 5: 18,015,570 L247H probably damaging Het
H2-D1 T G 17: 35,266,516 probably null Het
Hpf1 T G 8: 60,893,730 S26R possibly damaging Het
Ift80 T A 3: 68,914,940 N627I probably benign Het
Inpp5d A G 1: 87,665,451 K91R probably benign Het
Irgc1 C A 7: 24,432,813 R193L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lrrc9 T C 12: 72,477,386 W790R probably damaging Het
Man1a2 A G 3: 100,632,561 L188P probably damaging Het
Med8 A T 4: 118,410,892 E5V probably damaging Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Mettl25 A T 10: 105,779,648 C498* probably null Het
Mettl3 T A 14: 52,295,092 I545F probably damaging Het
Mvp T A 7: 126,993,549 I397F probably damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Nudt5 G A 2: 5,856,065 probably benign Het
Nyap2 T A 1: 81,336,729 D713E probably damaging Het
Obscn G A 11: 59,038,877 R5824C probably damaging Het
Olfr1310 G T 2: 112,008,250 S312Y probably damaging Het
Olfr807 T C 10: 129,755,418 I11V probably benign Het
Orc4 A T 2: 48,936,750 probably benign Het
Pde10a T A 17: 8,757,053 N3K possibly damaging Het
Pgm3 T A 9: 86,558,470 R389S probably benign Het
Piwil4 G A 9: 14,712,308 R529* probably null Het
Pkd2l2 A T 18: 34,409,836 R20* probably null Het
Ppp4r3a T A 12: 101,082,911 probably benign Het
Prkcq T C 2: 11,279,522 V501A possibly damaging Het
Prkg1 T C 19: 30,595,012 T400A probably damaging Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Prrc2c A T 1: 162,723,274 H40Q probably damaging Het
Ptcd1 A T 5: 145,155,175 H371Q probably benign Het
Ptprk T C 10: 28,263,690 I137T probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rapgef5 G A 12: 117,714,128 G366E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,919 probably benign Het
Setd2 A G 9: 110,594,132 D2085G possibly damaging Het
Sfxn3 A G 19: 45,050,874 probably null Het
Sgce T C 6: 4,689,560 probably benign Het
Sipa1l1 T A 12: 82,422,471 L1248* probably null Het
Skint7 T G 4: 111,982,112 M201R probably damaging Het
Slc18a1 A G 8: 69,043,931 M360T possibly damaging Het
Srp68 A T 11: 116,274,014 S31R probably benign Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Strc A T 2: 121,374,348 D985E possibly damaging Het
Tarsl2 T A 7: 65,689,969 V704E probably damaging Het
Tbc1d2b A G 9: 90,207,887 F863S probably damaging Het
Tek T C 4: 94,780,884 S41P probably damaging Het
Top1 T C 2: 160,712,717 Y463H probably damaging Het
Trim24 T G 6: 37,957,839 probably null Het
Ttn A G 2: 76,746,635 V24638A possibly damaging Het
Ttn A G 2: 76,870,869 probably benign Het
Txndc11 A G 16: 11,075,122 S915P probably benign Het
Tyro3 G C 2: 119,816,868 G826A probably benign Het
Ubxn4 T A 1: 128,274,850 W410R probably benign Het
Vmn1r193 C T 13: 22,219,525 G99D probably damaging Het
Vmn2r109 T A 17: 20,541,394 K567M probably damaging Het
Vmn2r23 T C 6: 123,741,730 F681L probably damaging Het
Vrk2 T C 11: 26,489,803 D256G probably damaging Het
Vwa3a T A 7: 120,778,915 I476N probably damaging Het
Wdr81 A G 11: 75,451,240 V1067A probably damaging Het
Zcwpw2 A G 9: 118,014,051 noncoding transcript Het
Other mutations in Dyrk1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Dyrk1a APN 16 94685084 missense probably benign 0.21
IGL01599:Dyrk1a APN 16 94691884 missense possibly damaging 0.94
IGL01809:Dyrk1a APN 16 94659617 missense probably benign 0.00
IGL02201:Dyrk1a APN 16 94692149 missense probably benign 0.05
IGL02345:Dyrk1a APN 16 94671362 missense possibly damaging 0.88
IGL02508:Dyrk1a APN 16 94685183 missense probably damaging 0.97
IGL02709:Dyrk1a APN 16 94685243 missense probably benign 0.08
IGL02713:Dyrk1a APN 16 94685345 splice site probably benign
R0414:Dyrk1a UTSW 16 94663842 missense probably damaging 1.00
R2107:Dyrk1a UTSW 16 94686527 missense probably damaging 1.00
R2394:Dyrk1a UTSW 16 94685132 missense probably benign 0.02
R3124:Dyrk1a UTSW 16 94668801 splice site probably benign
R3125:Dyrk1a UTSW 16 94668801 splice site probably benign
R3792:Dyrk1a UTSW 16 94685074 missense probably benign 0.31
R3963:Dyrk1a UTSW 16 94663746 missense probably benign 0.00
R4573:Dyrk1a UTSW 16 94692023 missense possibly damaging 0.90
R4965:Dyrk1a UTSW 16 94691995 nonsense probably null
R5326:Dyrk1a UTSW 16 94686581 missense probably damaging 0.98
R5540:Dyrk1a UTSW 16 94685343 critical splice donor site probably null
R5593:Dyrk1a UTSW 16 94659583 missense possibly damaging 0.64
R6313:Dyrk1a UTSW 16 94659514 missense probably damaging 0.99
R6396:Dyrk1a UTSW 16 94671440 missense probably damaging 1.00
R6524:Dyrk1a UTSW 16 94685120 missense probably benign 0.02
R7036:Dyrk1a UTSW 16 94686568 missense probably benign 0.09
R7326:Dyrk1a UTSW 16 94692043 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTATGGAGGTTGGCCACAG -3'
(R):5'- TTCAAGCAGCTTTGCACTTTTG -3'

Sequencing Primer
(F):5'- AGGTTGGCCACAGTCACCAC -3'
(R):5'- ACACCACTTCTATAAAAACACACAAG -3'
Posted On2015-10-08