Incidental Mutation 'R4653:Gtf3c1'
ID351477
Institutional Source Beutler Lab
Gene Symbol Gtf3c1
Ensembl Gene ENSMUSG00000032777
Gene Namegeneral transcription factor III C 1
Synonyms
MMRRC Submission 041913-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4653 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location125640954-125707780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125674100 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 622 (I622V)
Ref Sequence ENSEMBL: ENSMUSP00000145939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055506] [ENSMUST00000205444] [ENSMUST00000205659]
Predicted Effect probably benign
Transcript: ENSMUST00000055506
AA Change: I622V

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000056719
Gene: ENSMUSG00000032777
AA Change: I622V

DomainStartEndE-ValueType
Pfam:B-block_TFIIIC 174 250 5.1e-20 PFAM
low complexity region 344 354 N/A INTRINSIC
low complexity region 474 514 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 725 745 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 1158 1173 N/A INTRINSIC
low complexity region 1359 1372 N/A INTRINSIC
low complexity region 1423 1443 N/A INTRINSIC
low complexity region 1585 1620 N/A INTRINSIC
low complexity region 1895 1915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205444
Predicted Effect probably benign
Transcript: ENSMUST00000205659
AA Change: I622V

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205827
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,430 T351A probably benign Het
3930402G23Rik A T 8: 10,926,075 noncoding transcript Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Abca4 G T 3: 122,138,581 E295* probably null Het
Abi3 T C 11: 95,832,811 I215V probably benign Het
Adhfe1 G T 1: 9,550,578 probably benign Het
Akr1a1 A G 4: 116,637,959 probably benign Het
Ank T A 15: 27,590,361 W344R probably null Het
Cast A G 13: 74,746,014 S171P probably benign Het
Ccdc39 A G 3: 33,819,806 probably null Het
Cd180 T A 13: 102,704,908 L154H probably damaging Het
Cnp A T 11: 100,576,516 D95V probably benign Het
Cul1 T C 6: 47,484,963 I20T probably damaging Het
Dnah6 T C 6: 73,073,457 K3042R possibly damaging Het
Dpy19l1 A C 9: 24,482,054 S140A possibly damaging Het
Dpys C A 15: 39,793,246 R475L probably damaging Het
Dync1i2 A G 2: 71,247,855 N276S probably damaging Het
Ext2 T C 2: 93,696,159 S711G probably benign Het
Fam71e2 T C 7: 4,758,055 R553G possibly damaging Het
Fancm A G 12: 65,083,054 Y223C probably damaging Het
Folh1 C A 7: 86,744,425 G360* probably null Het
Gcat T C 15: 79,035,287 S151P probably damaging Het
Gcm2 A T 13: 41,102,841 D477E probably benign Het
Git1 A G 11: 77,505,043 N468S possibly damaging Het
Hsd17b13 G A 5: 103,965,836 L251F probably damaging Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Llgl1 A G 11: 60,708,651 D486G possibly damaging Het
Lrrk1 T C 7: 66,273,053 I1366V probably benign Het
Ly9 G T 1: 171,594,029 H441Q probably benign Het
Myo15b G A 11: 115,879,987 probably null Het
Nomo1 G T 7: 46,061,813 A639S probably benign Het
P3h2 T C 16: 26,105,277 D136G probably damaging Het
Pde4dip A T 3: 97,767,338 D87E probably damaging Het
Pdpk1 A T 17: 24,106,897 D108E probably benign Het
Pex26 C T 6: 121,190,125 S231L probably damaging Het
Prpf38b G A 3: 108,904,092 probably benign Het
Prpf4b A T 13: 34,899,971 M908L probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Ryr3 T A 2: 112,652,763 N4213I probably damaging Het
Slc7a14 A G 3: 31,257,682 V63A probably damaging Het
Soga1 A G 2: 157,040,591 F514L probably damaging Het
Sppl2a C T 2: 126,920,313 probably null Het
Sspo T A 6: 48,478,646 W3077R probably damaging Het
Stag1 T A 9: 100,796,716 M230K probably damaging Het
Sv2a T C 3: 96,190,762 probably null Het
Themis2 A G 4: 132,782,976 S638P probably benign Het
Trabd A G 15: 89,085,839 Y346C probably damaging Het
Trim38 A T 13: 23,782,969 D133V probably damaging Het
Trmt1l G A 1: 151,439,569 V16I probably benign Het
Ube2b A G 11: 51,995,372 probably null Het
Usp13 A T 3: 32,837,924 Q84L probably damaging Het
Vmn1r172 G T 7: 23,660,572 G294V probably damaging Het
Vmn2r59 A T 7: 42,043,804 H457Q probably benign Het
Vmn2r63 A G 7: 42,903,690 I714T possibly damaging Het
Vps8 T C 16: 21,500,210 Y602H probably damaging Het
Zbp1 G A 2: 173,207,815 P385S possibly damaging Het
Other mutations in Gtf3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Gtf3c1 APN 7 125644258 missense probably benign 0.15
IGL00535:Gtf3c1 APN 7 125644153 missense probably benign 0.00
IGL00778:Gtf3c1 APN 7 125667374 missense probably damaging 1.00
IGL00832:Gtf3c1 APN 7 125654460 splice site probably benign
IGL01383:Gtf3c1 APN 7 125699500 missense probably damaging 1.00
IGL01472:Gtf3c1 APN 7 125651054 splice site probably benign
IGL01743:Gtf3c1 APN 7 125663415 missense probably damaging 1.00
IGL01867:Gtf3c1 APN 7 125662376 missense probably benign 0.44
IGL02016:Gtf3c1 APN 7 125668039 missense probably damaging 1.00
IGL02096:Gtf3c1 APN 7 125659112 missense probably damaging 0.98
IGL02121:Gtf3c1 APN 7 125646731 nonsense probably null
IGL02226:Gtf3c1 APN 7 125667990 splice site probably null
IGL02376:Gtf3c1 APN 7 125668996 missense probably benign 0.41
IGL02581:Gtf3c1 APN 7 125646515 missense possibly damaging 0.80
IGL02750:Gtf3c1 APN 7 125676512 missense probably damaging 1.00
IGL03063:Gtf3c1 APN 7 125646503 missense possibly damaging 0.72
IGL03167:Gtf3c1 APN 7 125670580 critical splice acceptor site probably null
Godiva UTSW 7 125645534 missense possibly damaging 0.86
R0052:Gtf3c1 UTSW 7 125667971 intron probably null
R0266:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0378:Gtf3c1 UTSW 7 125647614 nonsense probably null
R0387:Gtf3c1 UTSW 7 125681104 missense probably damaging 1.00
R0426:Gtf3c1 UTSW 7 125663016 nonsense probably null
R0458:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0613:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0634:Gtf3c1 UTSW 7 125657477 unclassified probably benign
R0658:Gtf3c1 UTSW 7 125698962 missense probably damaging 1.00
R0904:Gtf3c1 UTSW 7 125668842 splice site probably benign
R1051:Gtf3c1 UTSW 7 125707649 missense probably damaging 1.00
R1481:Gtf3c1 UTSW 7 125693138 critical splice donor site probably null
R1590:Gtf3c1 UTSW 7 125676661 missense possibly damaging 0.90
R1782:Gtf3c1 UTSW 7 125667074 missense probably damaging 1.00
R1981:Gtf3c1 UTSW 7 125644272 missense possibly damaging 0.96
R2513:Gtf3c1 UTSW 7 125681173 missense probably benign 0.01
R2697:Gtf3c1 UTSW 7 125643954 missense probably damaging 0.98
R3963:Gtf3c1 UTSW 7 125693225 unclassified probably null
R4125:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4127:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4646:Gtf3c1 UTSW 7 125659094 missense possibly damaging 0.66
R4668:Gtf3c1 UTSW 7 125667338 missense probably damaging 1.00
R4803:Gtf3c1 UTSW 7 125663540 missense probably damaging 1.00
R5138:Gtf3c1 UTSW 7 125647492 missense probably benign 0.05
R5149:Gtf3c1 UTSW 7 125668037 missense probably damaging 0.99
R5286:Gtf3c1 UTSW 7 125663408 missense possibly damaging 0.79
R5437:Gtf3c1 UTSW 7 125667368 missense probably damaging 1.00
R5493:Gtf3c1 UTSW 7 125670544 missense probably damaging 1.00
R5610:Gtf3c1 UTSW 7 125703945 missense possibly damaging 0.94
R5656:Gtf3c1 UTSW 7 125662654 missense probably benign 0.27
R5754:Gtf3c1 UTSW 7 125644065 missense possibly damaging 0.86
R5969:Gtf3c1 UTSW 7 125645676 missense possibly damaging 0.91
R6009:Gtf3c1 UTSW 7 125647430 missense possibly damaging 0.66
R6223:Gtf3c1 UTSW 7 125676625 missense probably benign 0.01
R6580:Gtf3c1 UTSW 7 125644347 missense probably benign 0.02
R6628:Gtf3c1 UTSW 7 125668074 missense probably benign 0.04
R6774:Gtf3c1 UTSW 7 125641621 missense possibly damaging 0.93
R6781:Gtf3c1 UTSW 7 125659197 nonsense probably null
R6978:Gtf3c1 UTSW 7 125645534 missense possibly damaging 0.86
R7078:Gtf3c1 UTSW 7 125645742 missense possibly damaging 0.95
R7096:Gtf3c1 UTSW 7 125696559 critical splice acceptor site probably null
R7146:Gtf3c1 UTSW 7 125672821 missense possibly damaging 0.48
R7330:Gtf3c1 UTSW 7 125703883 missense probably benign 0.36
R7345:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
R7480:Gtf3c1 UTSW 7 125642541 missense probably benign 0.22
R7490:Gtf3c1 UTSW 7 125647491 missense not run
R7555:Gtf3c1 UTSW 7 125645670 missense not run
X0065:Gtf3c1 UTSW 7 125641690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCCTAGACACCTAGCATTTTC -3'
(R):5'- CTTGAAAAGGAGTGTGCCCCTC -3'

Sequencing Primer
(F):5'- AGGTCTACCCTTGCTAATGACAGG -3'
(R):5'- TGCCCCTCGGGTATAGTGTC -3'
Posted On2015-10-08