Incidental Mutation 'R4654:Phlpp1'
ID351507
Institutional Source Beutler Lab
Gene Symbol Phlpp1
Ensembl Gene ENSMUSG00000044340
Gene NamePH domain and leucine rich repeat protein phosphatase 1
SynonymsPhlpp, Plekhe1
MMRRC Submission 041914-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R4654 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location106171752-106394250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106339501 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 715 (M715L)
Ref Sequence ENSEMBL: ENSMUSP00000056530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061047]
Predicted Effect probably benign
Transcript: ENSMUST00000061047
AA Change: M715L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340
AA Change: M715L

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 96 N/A INTRINSIC
low complexity region 97 143 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
low complexity region 257 277 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 355 369 N/A INTRINSIC
PH 493 594 3.16e-2 SMART
LRR 615 634 4.75e2 SMART
LRR 648 669 7.16e0 SMART
LRR 669 688 1.48e1 SMART
LRR 692 714 2.14e1 SMART
LRR 715 738 1.37e1 SMART
LRR 786 809 3.27e1 SMART
LRR 849 868 8.11e0 SMART
LRR 872 895 1.97e1 SMART
LRR 895 914 2.55e1 SMART
LRR 919 940 1.86e1 SMART
LRR 941 960 1.67e1 SMART
LRR 991 1010 2.13e1 SMART
LRR 1015 1038 5.11e0 SMART
PP2Cc 1121 1376 2.62e-58 SMART
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1424 1445 N/A INTRINSIC
Blast:PP2Cc 1463 1555 2e-39 BLAST
low complexity region 1608 1624 N/A INTRINSIC
low complexity region 1640 1671 N/A INTRINSIC
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik T A 9: 35,908,991 C4S probably damaging Het
Adam3 A T 8: 24,703,803 C398S probably damaging Het
Adamts10 A G 17: 33,537,330 K316E possibly damaging Het
AI314180 A T 4: 58,834,523 I785N possibly damaging Het
Ap1m1 T C 8: 72,252,873 F238L possibly damaging Het
Aph1a T A 3: 95,895,776 D180E probably benign Het
Atp9b A G 18: 80,891,878 F201L probably benign Het
Btbd9 A C 17: 30,485,587 probably benign Het
C2cd5 T C 6: 143,030,184 T768A probably benign Het
Casq1 C T 1: 172,210,398 probably benign Het
Cltc A T 11: 86,726,370 M351K probably benign Het
Cnp A G 11: 100,579,051 E271G possibly damaging Het
Col22a1 T C 15: 71,973,695 D406G possibly damaging Het
Cylc2 T C 4: 51,228,279 S117P probably benign Het
Cyp2b13 T C 7: 26,061,647 L43P probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dclk2 T C 3: 86,836,376 D262G probably damaging Het
Dcun1d3 A C 7: 119,859,519 Y98D probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dennd5b T C 6: 149,006,837 N986S probably damaging Het
Dusp9 G A X: 73,640,772 R182Q probably benign Het
Edil3 A G 13: 89,289,470 K397E probably damaging Het
Ehd1 T C 19: 6,276,964 probably benign Het
Fam13a A T 6: 58,987,167 H93Q probably benign Het
Fam207a T C 10: 77,490,026 M170V possibly damaging Het
Fam69a T C 5: 107,910,116 probably null Het
Farp1 T C 14: 121,276,304 I837T possibly damaging Het
Fbxl5 T A 5: 43,765,429 I216F probably damaging Het
Gadl1 G A 9: 115,941,340 E74K probably damaging Het
Gnpnat1 A G 14: 45,380,979 V122A probably damaging Het
Hdac10 C T 15: 89,126,833 probably benign Het
Heatr5b T C 17: 78,820,701 S502G possibly damaging Het
Hr C A 14: 70,563,573 A695E probably damaging Het
Ift80 A T 3: 68,918,537 I490N possibly damaging Het
Ipo11 A G 13: 106,834,184 probably benign Het
Iqch T G 9: 63,524,913 Y400S probably damaging Het
Jag2 C T 12: 112,913,646 D702N probably benign Het
Kiss1r T A 10: 79,921,790 L326Q probably damaging Het
Lexm C A 4: 106,610,415 M341I probably benign Het
Lrrc42 A T 4: 107,247,549 I73N probably damaging Het
Lrrc55 C T 2: 85,196,536 G48D possibly damaging Het
Lrrk2 T C 15: 91,765,681 S1674P probably damaging Het
Mctp2 A G 7: 72,090,194 L816P probably damaging Het
Mipol1 A T 12: 57,306,132 T86S probably benign Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Mmp1b A G 9: 7,370,849 V302A probably benign Het
Msc A T 1: 14,755,829 probably null Het
Msmo1 C A 8: 64,727,854 V9L probably benign Het
Nbeal2 G A 9: 110,632,004 R1630C probably damaging Het
Nlgn1 C T 3: 26,133,701 V12I possibly damaging Het
Npas3 T C 12: 54,062,132 probably null Het
Nr2e3 A G 9: 59,949,072 probably benign Het
Oca2 C T 7: 56,328,812 A576V probably benign Het
Olfr1444 T A 19: 12,862,232 C152* probably null Het
Olfr212 T C 6: 116,516,448 Y224H probably damaging Het
Olfr5 T C 7: 6,481,046 T37A probably benign Het
Parp6 A G 9: 59,641,100 probably null Het
Pi4k2a G A 19: 42,113,105 probably null Het
Pik3ap1 A G 19: 41,327,909 S305P probably damaging Het
Plcg2 G A 8: 117,504,315 M45I probably benign Het
Ppm1m A T 9: 106,196,402 L317H probably damaging Het
Ppp1r21 T G 17: 88,558,799 M341R probably benign Het
Prdx3 A G 19: 60,865,236 V217A possibly damaging Het
Ptk2b A G 14: 66,163,047 V773A possibly damaging Het
Raly T C 2: 154,857,456 V60A probably damaging Het
Reps1 A G 10: 18,114,400 D420G probably damaging Het
Rev1 A T 1: 38,079,256 probably benign Het
Rgs2 T G 1: 144,002,912 probably benign Het
Rlf G T 4: 121,150,601 T394K probably benign Het
Rptn A T 3: 93,397,485 R708S possibly damaging Het
Sec23b T A 2: 144,572,574 M402K probably benign Het
Skiv2l A G 17: 34,849,946 C26R probably damaging Het
Smpd4 A G 16: 17,642,128 probably benign Het
Synj2 A G 17: 6,013,538 E434G probably damaging Het
Tatdn2 T A 6: 113,707,365 F64I probably benign Het
Tex21 A C 12: 76,217,086 H177Q probably benign Het
Tln1 T A 4: 43,535,954 Q2077L probably null Het
Tnrc6c T C 11: 117,720,971 V145A probably benign Het
Ttn C T 2: 76,786,592 probably benign Het
Uggt2 A G 14: 119,032,258 F954S possibly damaging Het
Ugt2a1 A G 5: 87,486,224 S175P probably damaging Het
Vcl A G 14: 20,985,752 probably null Het
Vegfa A T 17: 46,025,250 probably benign Het
Vmn2r68 G A 7: 85,233,561 Q328* probably null Het
Vmn2r7 A G 3: 64,719,443 Y142H probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ybx3 G T 6: 131,370,327 R282S probably damaging Het
Zfp566 T C 7: 30,077,769 H329R probably damaging Het
Zfp786 T C 6: 47,820,934 I357V probably benign Het
Zfr2 C A 10: 81,251,249 probably null Het
Other mutations in Phlpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Phlpp1 APN 1 106376255 missense probably damaging 1.00
IGL00848:Phlpp1 APN 1 106339448 missense probably damaging 1.00
IGL01122:Phlpp1 APN 1 106173436 missense possibly damaging 0.51
IGL01588:Phlpp1 APN 1 106380389 missense probably damaging 1.00
IGL02145:Phlpp1 APN 1 106389883 missense probably damaging 0.96
IGL02417:Phlpp1 APN 1 106392714 missense probably benign 0.00
IGL02863:Phlpp1 APN 1 106376297 splice site probably null
IGL03178:Phlpp1 APN 1 106392388 missense probably damaging 0.99
R0400:Phlpp1 UTSW 1 106392934 missense probably benign 0.35
R0423:Phlpp1 UTSW 1 106339615 missense probably benign 0.03
R0449:Phlpp1 UTSW 1 106350578 missense probably damaging 0.98
R0765:Phlpp1 UTSW 1 106392283 missense probably damaging 1.00
R0884:Phlpp1 UTSW 1 106389665 splice site probably null
R1394:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1395:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1428:Phlpp1 UTSW 1 106380425 splice site probably null
R1438:Phlpp1 UTSW 1 106173412 missense possibly damaging 0.53
R1521:Phlpp1 UTSW 1 106392319 missense probably damaging 1.00
R1572:Phlpp1 UTSW 1 106392789 missense probably damaging 1.00
R1588:Phlpp1 UTSW 1 106380385 missense probably damaging 1.00
R1843:Phlpp1 UTSW 1 106343505 missense probably benign 0.40
R1889:Phlpp1 UTSW 1 106318850 missense possibly damaging 0.95
R2404:Phlpp1 UTSW 1 106172839 missense probably benign 0.22
R2942:Phlpp1 UTSW 1 106172772 missense probably benign 0.00
R3774:Phlpp1 UTSW 1 106393191 small deletion probably benign
R3832:Phlpp1 UTSW 1 106392597 missense probably damaging 1.00
R4029:Phlpp1 UTSW 1 106392549 missense probably damaging 0.98
R4086:Phlpp1 UTSW 1 106347161 missense probably benign 0.03
R4112:Phlpp1 UTSW 1 106364338 missense probably damaging 1.00
R4472:Phlpp1 UTSW 1 106386446 missense probably damaging 1.00
R4908:Phlpp1 UTSW 1 106389751 missense probably damaging 1.00
R5027:Phlpp1 UTSW 1 106281471 missense probably damaging 1.00
R5199:Phlpp1 UTSW 1 106173394 missense probably damaging 0.98
R5352:Phlpp1 UTSW 1 106172725 missense probably benign 0.07
R5508:Phlpp1 UTSW 1 106364390 missense probably benign 0.02
R5570:Phlpp1 UTSW 1 106173432 missense probably benign 0.01
R5590:Phlpp1 UTSW 1 106392927 missense possibly damaging 0.95
R5838:Phlpp1 UTSW 1 106347132 nonsense probably null
R5955:Phlpp1 UTSW 1 106364230 splice site probably null
R5992:Phlpp1 UTSW 1 106318993 nonsense probably null
R6469:Phlpp1 UTSW 1 106287103 missense probably damaging 1.00
R6821:Phlpp1 UTSW 1 106386444 missense probably damaging 0.98
R6952:Phlpp1 UTSW 1 106172479 missense probably benign 0.04
R7101:Phlpp1 UTSW 1 106172667 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGTCCCTATTTGTGATCTCCG -3'
(R):5'- GGGGTTACCTTAGGTCCACATG -3'

Sequencing Primer
(F):5'- TGCCTTGTCTTTATGAATTTTTGCAG -3'
(R):5'- GGTCCACATGTTTAATATGAGGC -3'
Posted On2015-10-08