Incidental Mutation 'R4654:Tnrc6c'
ID351564
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Nametrinucleotide repeat containing 6C
Synonyms9930033H14Rik
MMRRC Submission 041914-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4654 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117654289-117763439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117720971 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 145 (V145A)
Ref Sequence ENSEMBL: ENSMUSP00000101951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
Predicted Effect probably benign
Transcript: ENSMUST00000026658
AA Change: V145A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: V145A

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106344
AA Change: V145A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: V145A

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138299
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141115
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (98/101)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230113P08Rik T A 9: 35,908,991 C4S probably damaging Het
Adam3 A T 8: 24,703,803 C398S probably damaging Het
Adamts10 A G 17: 33,537,330 K316E possibly damaging Het
AI314180 A T 4: 58,834,523 I785N possibly damaging Het
Ap1m1 T C 8: 72,252,873 F238L possibly damaging Het
Aph1a T A 3: 95,895,776 D180E probably benign Het
Atp9b A G 18: 80,891,878 F201L probably benign Het
Btbd9 A C 17: 30,485,587 probably benign Het
C2cd5 T C 6: 143,030,184 T768A probably benign Het
Casq1 C T 1: 172,210,398 probably benign Het
Cltc A T 11: 86,726,370 M351K probably benign Het
Cnp A G 11: 100,579,051 E271G possibly damaging Het
Col22a1 T C 15: 71,973,695 D406G possibly damaging Het
Cylc2 T C 4: 51,228,279 S117P probably benign Het
Cyp2b13 T C 7: 26,061,647 L43P probably damaging Het
Cyp3a16 A G 5: 145,436,457 V500A probably benign Het
Dclk2 T C 3: 86,836,376 D262G probably damaging Het
Dcun1d3 A C 7: 119,859,519 Y98D probably damaging Het
Ddx39b A G 17: 35,253,488 *429W probably null Het
Dennd5b T C 6: 149,006,837 N986S probably damaging Het
Dusp9 G A X: 73,640,772 R182Q probably benign Het
Edil3 A G 13: 89,289,470 K397E probably damaging Het
Ehd1 T C 19: 6,276,964 probably benign Het
Fam13a A T 6: 58,987,167 H93Q probably benign Het
Fam207a T C 10: 77,490,026 M170V possibly damaging Het
Fam69a T C 5: 107,910,116 probably null Het
Farp1 T C 14: 121,276,304 I837T possibly damaging Het
Fbxl5 T A 5: 43,765,429 I216F probably damaging Het
Gadl1 G A 9: 115,941,340 E74K probably damaging Het
Gnpnat1 A G 14: 45,380,979 V122A probably damaging Het
Hdac10 C T 15: 89,126,833 probably benign Het
Heatr5b T C 17: 78,820,701 S502G possibly damaging Het
Hr C A 14: 70,563,573 A695E probably damaging Het
Ift80 A T 3: 68,918,537 I490N possibly damaging Het
Ipo11 A G 13: 106,834,184 probably benign Het
Iqch T G 9: 63,524,913 Y400S probably damaging Het
Jag2 C T 12: 112,913,646 D702N probably benign Het
Kiss1r T A 10: 79,921,790 L326Q probably damaging Het
Lexm C A 4: 106,610,415 M341I probably benign Het
Lrrc42 A T 4: 107,247,549 I73N probably damaging Het
Lrrc55 C T 2: 85,196,536 G48D possibly damaging Het
Lrrk2 T C 15: 91,765,681 S1674P probably damaging Het
Mctp2 A G 7: 72,090,194 L816P probably damaging Het
Mipol1 A T 12: 57,306,132 T86S probably benign Het
Mkrn3 C T 7: 62,419,704 R113H probably damaging Het
Mmp1b A G 9: 7,370,849 V302A probably benign Het
Msc A T 1: 14,755,829 probably null Het
Msmo1 C A 8: 64,727,854 V9L probably benign Het
Nbeal2 G A 9: 110,632,004 R1630C probably damaging Het
Nlgn1 C T 3: 26,133,701 V12I possibly damaging Het
Npas3 T C 12: 54,062,132 probably null Het
Nr2e3 A G 9: 59,949,072 probably benign Het
Oca2 C T 7: 56,328,812 A576V probably benign Het
Olfr1444 T A 19: 12,862,232 C152* probably null Het
Olfr212 T C 6: 116,516,448 Y224H probably damaging Het
Olfr5 T C 7: 6,481,046 T37A probably benign Het
Parp6 A G 9: 59,641,100 probably null Het
Phlpp1 A T 1: 106,339,501 M715L probably benign Het
Pi4k2a G A 19: 42,113,105 probably null Het
Pik3ap1 A G 19: 41,327,909 S305P probably damaging Het
Plcg2 G A 8: 117,504,315 M45I probably benign Het
Ppm1m A T 9: 106,196,402 L317H probably damaging Het
Ppp1r21 T G 17: 88,558,799 M341R probably benign Het
Prdx3 A G 19: 60,865,236 V217A possibly damaging Het
Ptk2b A G 14: 66,163,047 V773A possibly damaging Het
Raly T C 2: 154,857,456 V60A probably damaging Het
Reps1 A G 10: 18,114,400 D420G probably damaging Het
Rev1 A T 1: 38,079,256 probably benign Het
Rgs2 T G 1: 144,002,912 probably benign Het
Rlf G T 4: 121,150,601 T394K probably benign Het
Rptn A T 3: 93,397,485 R708S possibly damaging Het
Sec23b T A 2: 144,572,574 M402K probably benign Het
Skiv2l A G 17: 34,849,946 C26R probably damaging Het
Smpd4 A G 16: 17,642,128 probably benign Het
Synj2 A G 17: 6,013,538 E434G probably damaging Het
Tatdn2 T A 6: 113,707,365 F64I probably benign Het
Tex21 A C 12: 76,217,086 H177Q probably benign Het
Tln1 T A 4: 43,535,954 Q2077L probably null Het
Ttn C T 2: 76,786,592 probably benign Het
Uggt2 A G 14: 119,032,258 F954S possibly damaging Het
Ugt2a1 A G 5: 87,486,224 S175P probably damaging Het
Vcl A G 14: 20,985,752 probably null Het
Vegfa A T 17: 46,025,250 probably benign Het
Vmn2r68 G A 7: 85,233,561 Q328* probably null Het
Vmn2r7 A G 3: 64,719,443 Y142H probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ybx3 G T 6: 131,370,327 R282S probably damaging Het
Zfp566 T C 7: 30,077,769 H329R probably damaging Het
Zfp786 T C 6: 47,820,934 I357V probably benign Het
Zfr2 C A 10: 81,251,249 probably null Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117714185 missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117722029 missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117721985 missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117714257 missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117723113 missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117749335 splice site probably benign
IGL01869:Tnrc6c APN 11 117755448 missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117721199 missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117722977 missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117743000 missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117732170 missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117749825 splice site probably benign
rodion UTSW 11 117738350 critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117760738 missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117721458 missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117752985 missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117760549 missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117722621 missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117721922 missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117721674 missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117733703 missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117759637 missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117758041 missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117760730 missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117714362 missense probably benign
R1901:Tnrc6c UTSW 11 117723005 missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117749625 missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117723124 missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117723229 missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117755483 missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117722498 missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4765:Tnrc6c UTSW 11 117742927 missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117722905 missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117721046 missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117721046 missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117738350 critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117723287 missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117758905 splice site silent
R5428:Tnrc6c UTSW 11 117700762 start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117760843 missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117749271 nonsense probably null
R5875:Tnrc6c UTSW 11 117759708 missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117722519 missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117736005 missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117749614 missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117722741 missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117733618 missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117721974 missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117714126 missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117723528 missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117741780 missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117721954 missense probably benign
V7580:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGAAACATTCGGGGTTTTAAGG -3'
(R):5'- TTGGAGGCAGAGTCAGTGTC -3'

Sequencing Primer
(F):5'- CCCAGGAACTTAGATGTGCTG -3'
(R):5'- CGGTAGGACATTCTGAGGCAGATTC -3'
Posted On2015-10-08