Incidental Mutation 'R4640:Kera'
ID351615
Institutional Source Beutler Lab
Gene Symbol Kera
Ensembl Gene ENSMUSG00000019932
Gene Namekeratocan
SynonymsSLRR2B, CNA2
MMRRC Submission 041902-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4640 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location97606879-97613692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97612887 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 323 (Y323F)
Ref Sequence ENSEMBL: ENSMUSP00000100923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105286]
Predicted Effect probably damaging
Transcript: ENSMUST00000105286
AA Change: Y323F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100923
Gene: ENSMUSG00000019932
AA Change: Y323F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 42 76 1.9e-14 SMART
LRR 71 90 2.5e-1 SMART
LRR 121 140 2.1e-1 SMART
LRR 142 161 1.5e0 SMART
LRR 166 191 3.4e-2 SMART
LRR 192 215 2.8e-2 SMART
LRR 213 232 9.2e-1 SMART
Blast:LRR 237 261 4e-8 BLAST
LRR 262 281 6.3e-2 SMART
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a keratan sulfate proteoglycan that is involved in corneal transparency. Defects in this gene are a cause of autosomal recessive cornea plana 2 (CNA2).[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a thinner than normal corneal stroma with thicker collagen fibers which were less regularly packed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl4 T C 3: 151,500,310 probably benign Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
Atp11a A G 8: 12,828,434 probably benign Het
Cct4 T A 11: 23,002,297 S463T probably benign Het
Cnmd T C 14: 79,656,653 N98S probably damaging Het
Copz2 A T 11: 96,856,707 Q172L possibly damaging Het
Ctdp1 C A 18: 80,451,154 probably null Het
Cyfip1 C T 7: 55,913,451 T865I possibly damaging Het
Cyp2c37 A T 19: 40,011,832 D466V possibly damaging Het
Dytn A G 1: 63,643,348 L380P possibly damaging Het
Fam124b G A 1: 80,213,526 R47C probably damaging Het
Foxe3 G A 4: 114,925,775 A80V probably damaging Het
Gm5884 A G 6: 128,645,771 noncoding transcript Het
Lipf A T 19: 33,968,797 Y205F probably damaging Het
Lipo2 T C 19: 33,720,837 E380G probably benign Het
Mcm2 A T 6: 88,887,804 H563Q possibly damaging Het
Mindy3 T C 2: 12,348,163 E409G probably benign Het
Mns1 A G 9: 72,439,282 K16E probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nlrp4g T C 9: 124,349,153 noncoding transcript Het
Nrxn1 A G 17: 90,560,768 S1105P probably damaging Het
Odf2l G A 3: 145,128,945 R186H probably damaging Het
Olfr309 T A 7: 86,307,066 T16S probably benign Het
Olfr709-ps1 T C 7: 106,926,593 I289V possibly damaging Het
Phxr2 T C 10: 99,126,069 probably benign Het
Plcxd3 T C 15: 4,517,243 F243S probably damaging Het
Ppp1r27 T C 11: 120,550,727 N76D possibly damaging Het
Ptprz1 A G 6: 22,972,798 T236A probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hdm1 T C 1: 128,175,238 probably benign Het
Sall2 T A 14: 52,315,159 Q193L probably damaging Het
Srpk1 T C 17: 28,608,724 S39G probably benign Het
Tcaf3 A G 6: 42,587,579 V883A probably damaging Het
Tmem104 T A 11: 115,243,724 V362E probably damaging Het
Wdr66 G T 5: 123,302,432 V1094L probably benign Het
Other mutations in Kera
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Kera APN 10 97609077 missense possibly damaging 0.79
R1309:Kera UTSW 10 97609426 missense possibly damaging 0.82
R1830:Kera UTSW 10 97609147 missense probably benign 0.29
R1895:Kera UTSW 10 97609147 missense probably benign 0.29
R1946:Kera UTSW 10 97609147 missense probably benign 0.29
R2365:Kera UTSW 10 97608943 missense probably benign 0.44
R3957:Kera UTSW 10 97612845 missense probably benign
R4198:Kera UTSW 10 97612973 makesense probably null
R4624:Kera UTSW 10 97609631 missense probably benign 0.00
R4625:Kera UTSW 10 97609631 missense probably benign 0.00
R4628:Kera UTSW 10 97609631 missense probably benign 0.00
R4629:Kera UTSW 10 97609631 missense probably benign 0.00
R6496:Kera UTSW 10 97612810 missense probably benign
R6767:Kera UTSW 10 97609172 missense possibly damaging 0.92
R6999:Kera UTSW 10 97608952 missense probably damaging 1.00
R7017:Kera UTSW 10 97609077 missense possibly damaging 0.79
R7117:Kera UTSW 10 97612852 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTAGGACCACTGTAGTGTC -3'
(R):5'- TCACTGACCAGAGCATCCTC -3'

Sequencing Primer
(F):5'- AGGACCACTGTAGTGTCTTCTTG -3'
(R):5'- TAAGAACAATTGCAAGTGTGGTC -3'
Posted On2015-10-08