Incidental Mutation 'R4640:Cnmd'
ID 351622
Institutional Source Beutler Lab
Gene Symbol Cnmd
Ensembl Gene ENSMUSG00000022025
Gene Name chondromodulin
Synonyms Bricd3, Chondromodulin 1, Chmd, ChM-I, Lect1
MMRRC Submission 041902-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4640 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 79875130-79899610 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79894093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 98 (N98S)
Ref Sequence ENSEMBL: ENSMUSP00000126958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022603] [ENSMUST00000165835]
AlphaFold Q9Z1F6
Predicted Effect probably damaging
Transcript: ENSMUST00000022603
AA Change: N98S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022603
Gene: ENSMUSG00000022025
AA Change: N98S

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
BRICHOS 105 201 1.24e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165835
AA Change: N98S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126958
Gene: ENSMUSG00000022025
AA Change: N98S

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
BRICHOS 105 201 1.24e-33 SMART
Meta Mutation Damage Score 0.1643 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and show no gross morphologic defects. While cartilage development and embryonic endochondral bone formation were found to be normal in mutant mice, one line of targeted mutants showed increased bone density and impairedbone resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adgrl4 T C 3: 151,205,947 (GRCm39) probably benign Het
Ano4 C T 10: 88,790,559 (GRCm39) A847T probably damaging Het
Atp11a A G 8: 12,878,434 (GRCm39) probably benign Het
Cct4 T A 11: 22,952,297 (GRCm39) S463T probably benign Het
Cfap251 G T 5: 123,440,495 (GRCm39) V1094L probably benign Het
Copz2 A T 11: 96,747,533 (GRCm39) Q172L possibly damaging Het
Ctdp1 C A 18: 80,494,369 (GRCm39) probably null Het
Cyfip1 C T 7: 55,563,199 (GRCm39) T865I possibly damaging Het
Cyp2c37 A T 19: 40,000,276 (GRCm39) D466V possibly damaging Het
Dytn A G 1: 63,682,507 (GRCm39) L380P possibly damaging Het
Fam124b G A 1: 80,191,243 (GRCm39) R47C probably damaging Het
Foxe3 G A 4: 114,782,972 (GRCm39) A80V probably damaging Het
Gm5884 A G 6: 128,622,734 (GRCm39) noncoding transcript Het
Kera A T 10: 97,448,749 (GRCm39) Y323F probably damaging Het
Lipf A T 19: 33,946,197 (GRCm39) Y205F probably damaging Het
Lipo2 T C 19: 33,698,237 (GRCm39) E380G probably benign Het
Mcm2 A T 6: 88,864,786 (GRCm39) H563Q possibly damaging Het
Mindy3 T C 2: 12,352,974 (GRCm39) E409G probably benign Het
Mns1 A G 9: 72,346,564 (GRCm39) K16E probably benign Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nlrp4g T C 9: 124,349,153 (GRCm38) noncoding transcript Het
Nrxn1 A G 17: 90,868,196 (GRCm39) S1105P probably damaging Het
Odf2l G A 3: 144,834,706 (GRCm39) R186H probably damaging Het
Or13g1 T A 7: 85,956,274 (GRCm39) T16S probably benign Het
Or2d3c T C 7: 106,525,800 (GRCm39) I289V possibly damaging Het
Phxr2 T C 10: 98,961,931 (GRCm39) probably benign Het
Plcxd3 T C 15: 4,546,725 (GRCm39) F243S probably damaging Het
Ppp1r27 T C 11: 120,441,553 (GRCm39) N76D possibly damaging Het
Ptprz1 A G 6: 22,972,797 (GRCm39) T236A probably damaging Het
Pyroxd1 C G 6: 142,300,467 (GRCm39) S199* probably null Het
R3hdm1 T C 1: 128,102,975 (GRCm39) probably benign Het
Sall2 T A 14: 52,552,616 (GRCm39) Q193L probably damaging Het
Srpk1 T C 17: 28,827,698 (GRCm39) S39G probably benign Het
Tcaf3 A G 6: 42,564,513 (GRCm39) V883A probably damaging Het
Tmem104 T A 11: 115,134,550 (GRCm39) V362E probably damaging Het
Other mutations in Cnmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cnmd APN 14 79,879,508 (GRCm39) splice site probably benign
IGL02556:Cnmd APN 14 79,899,400 (GRCm39) missense probably benign 0.00
IGL03034:Cnmd APN 14 79,879,368 (GRCm39) missense probably benign
R0529:Cnmd UTSW 14 79,879,481 (GRCm39) missense probably benign 0.00
R0811:Cnmd UTSW 14 79,898,863 (GRCm39) missense probably damaging 1.00
R0812:Cnmd UTSW 14 79,898,863 (GRCm39) missense probably damaging 1.00
R0844:Cnmd UTSW 14 79,879,391 (GRCm39) missense probably benign 0.37
R2401:Cnmd UTSW 14 79,894,045 (GRCm39) missense probably damaging 0.98
R2419:Cnmd UTSW 14 79,875,488 (GRCm39) missense probably damaging 1.00
R3697:Cnmd UTSW 14 79,875,421 (GRCm39) missense probably damaging 1.00
R4841:Cnmd UTSW 14 79,887,762 (GRCm39) missense possibly damaging 0.94
R4845:Cnmd UTSW 14 79,899,448 (GRCm39) missense probably benign
R5157:Cnmd UTSW 14 79,894,126 (GRCm39) missense probably benign 0.39
R5959:Cnmd UTSW 14 79,894,109 (GRCm39) missense probably damaging 1.00
R6033:Cnmd UTSW 14 79,898,945 (GRCm39) missense probably benign 0.00
R6033:Cnmd UTSW 14 79,898,945 (GRCm39) missense probably benign 0.00
R7421:Cnmd UTSW 14 79,882,947 (GRCm39) missense probably benign 0.25
R7640:Cnmd UTSW 14 79,898,974 (GRCm39) missense possibly damaging 0.86
R8007:Cnmd UTSW 14 79,875,406 (GRCm39) missense probably damaging 1.00
R8350:Cnmd UTSW 14 79,882,821 (GRCm39) nonsense probably null
R8450:Cnmd UTSW 14 79,882,821 (GRCm39) nonsense probably null
R9009:Cnmd UTSW 14 79,894,085 (GRCm39) missense probably damaging 1.00
R9745:Cnmd UTSW 14 79,887,850 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CCGAGAAGCTGCTGTTGAGAAC -3'
(R):5'- AGCTGACTGGTATATGGATAGATTCC -3'

Sequencing Primer
(F):5'- AGTAACCACTGCGTGCGTG -3'
(R):5'- CCAAAGACTCTTGTTCTCC -3'
Posted On 2015-10-08