Incidental Mutation 'R4643:Zfp663'
ID351715
Institutional Source Beutler Lab
Gene Symbol Zfp663
Ensembl Gene ENSMUSG00000056824
Gene Namezinc finger protein 663
SynonymsGm1008, LOC381405
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165351297-165368729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 165353005 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 431 (H431Q)
Ref Sequence ENSEMBL: ENSMUSP00000099374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073062] [ENSMUST00000103085] [ENSMUST00000141140]
Predicted Effect probably benign
Transcript: ENSMUST00000073062
AA Change: H431Q

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072813
Gene: ENSMUSG00000056824
AA Change: H431Q

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
ZnF_C2H2 205 227 3.47e1 SMART
ZnF_C2H2 472 494 2.4e-3 SMART
ZnF_C2H2 500 522 2.99e-4 SMART
ZnF_C2H2 528 550 2.43e-4 SMART
ZnF_C2H2 556 578 4.79e-3 SMART
ZnF_C2H2 584 606 3.95e-4 SMART
ZnF_C2H2 612 635 8.6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103085
AA Change: H431Q

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099374
Gene: ENSMUSG00000056824
AA Change: H431Q

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
ZnF_C2H2 205 227 3.47e1 SMART
ZnF_C2H2 472 494 2.4e-3 SMART
ZnF_C2H2 500 522 2.99e-4 SMART
ZnF_C2H2 528 550 2.43e-4 SMART
ZnF_C2H2 556 578 4.79e-3 SMART
ZnF_C2H2 584 606 3.95e-4 SMART
ZnF_C2H2 612 635 8.6e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136482
Predicted Effect probably benign
Transcript: ENSMUST00000141140
SMART Domains Protein: ENSMUSP00000115254
Gene: ENSMUSG00000056824

DomainStartEndE-ValueType
KRAB 8 68 1.97e-31 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Other mutations in Zfp663
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Zfp663 APN 2 165352605 missense probably damaging 1.00
IGL01382:Zfp663 APN 2 165359015 missense probably damaging 1.00
IGL02007:Zfp663 APN 2 165359073 missense probably benign 0.12
IGL02164:Zfp663 APN 2 165359048 nonsense probably null
IGL02506:Zfp663 APN 2 165353951 missense probably benign 0.35
IGL03173:Zfp663 APN 2 165352499 missense probably damaging 0.99
R0735:Zfp663 UTSW 2 165359075 missense probably damaging 0.97
R1395:Zfp663 UTSW 2 165352572 missense probably damaging 1.00
R1402:Zfp663 UTSW 2 165353970 missense probably benign 0.14
R1402:Zfp663 UTSW 2 165353970 missense probably benign 0.14
R1503:Zfp663 UTSW 2 165352653 missense probably damaging 0.99
R1587:Zfp663 UTSW 2 165353517 missense probably benign
R1854:Zfp663 UTSW 2 165353291 missense probably benign 0.18
R1867:Zfp663 UTSW 2 165352731 missense possibly damaging 0.74
R3031:Zfp663 UTSW 2 165353696 nonsense probably null
R4691:Zfp663 UTSW 2 165359130 intron probably benign
R4977:Zfp663 UTSW 2 165353811 missense probably damaging 0.97
R5135:Zfp663 UTSW 2 165353670 missense possibly damaging 0.95
R5151:Zfp663 UTSW 2 165353193 missense probably benign 0.00
R5639:Zfp663 UTSW 2 165353009 missense probably benign 0.03
R5763:Zfp663 UTSW 2 165358435 nonsense probably null
R6776:Zfp663 UTSW 2 165359015 missense probably damaging 1.00
R6929:Zfp663 UTSW 2 165353258 missense probably benign
R6998:Zfp663 UTSW 2 165354002 missense possibly damaging 0.74
R7035:Zfp663 UTSW 2 165353103 missense probably benign 0.36
R7169:Zfp663 UTSW 2 165352439 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGACTTGACACAGAACGAC -3'
(R):5'- CCGGAAAACTTGCACAGCAG -3'

Sequencing Primer
(F):5'- GCAGAAAGTTTTCCCACATTCG -3'
(R):5'- GCAGAAAAACCCAAGTGTGC -3'
Posted On2015-10-08