Incidental Mutation 'R4643:L1td1'
ID351721
Institutional Source Beutler Lab
Gene Symbol L1td1
Ensembl Gene ENSMUSG00000087166
Gene NameLINE-1 type transposase domain containing 1
SynonymsECAT11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location98726734-98738480 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98737883 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 772 (S772P)
Ref Sequence ENSEMBL: ENSMUSP00000134149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000152889] [ENSMUST00000154279] [ENSMUST00000171708] [ENSMUST00000173659]
Predicted Effect probably benign
Transcript: ENSMUST00000152889
Predicted Effect possibly damaging
Transcript: ENSMUST00000154279
AA Change: S706P

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127504
Gene: ENSMUSG00000087166
AA Change: S706P

DomainStartEndE-ValueType
Pfam:Transposase_22 175 295 4e-21 PFAM
low complexity region 346 397 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
Pfam:Transposase_22 495 782 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171708
Predicted Effect probably damaging
Transcript: ENSMUST00000173659
AA Change: S772P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134149
Gene: ENSMUSG00000087166
AA Change: S772P

DomainStartEndE-ValueType
Pfam:Transposase_22 175 291 6e-20 PFAM
coiled coil region 383 431 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Pfam:Transposase_22 568 848 4.3e-57 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal development and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in L1td1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:L1td1 APN 4 98737344 missense probably damaging 0.99
IGL02529:L1td1 APN 4 98737421 missense probably benign 0.01
R0254:L1td1 UTSW 4 98737182 nonsense probably null
R0924:L1td1 UTSW 4 98737625 missense probably damaging 1.00
R0930:L1td1 UTSW 4 98737625 missense probably damaging 1.00
R1434:L1td1 UTSW 4 98737817 missense possibly damaging 0.91
R1573:L1td1 UTSW 4 98737280 missense probably benign 0.01
R1751:L1td1 UTSW 4 98737449 missense probably benign 0.32
R1767:L1td1 UTSW 4 98737449 missense probably benign 0.32
R1870:L1td1 UTSW 4 98737477 missense possibly damaging 0.93
R2006:L1td1 UTSW 4 98733489 missense possibly damaging 0.53
R2252:L1td1 UTSW 4 98737637 unclassified probably null
R2383:L1td1 UTSW 4 98737722 missense possibly damaging 0.93
R2472:L1td1 UTSW 4 98733159 unclassified probably benign
R3195:L1td1 UTSW 4 98737518 missense possibly damaging 0.47
R3763:L1td1 UTSW 4 98737835 missense probably damaging 0.99
R3950:L1td1 UTSW 4 98737353 missense probably benign 0.12
R3962:L1td1 UTSW 4 98737449 missense probably benign 0.32
R4430:L1td1 UTSW 4 98737151 missense probably benign 0.00
R4661:L1td1 UTSW 4 98733624 missense possibly damaging 0.94
R4885:L1td1 UTSW 4 98737311 missense probably benign 0.01
R5345:L1td1 UTSW 4 98736447 missense probably damaging 1.00
R5589:L1td1 UTSW 4 98738104 missense possibly damaging 0.66
R5800:L1td1 UTSW 4 98733762 missense possibly damaging 0.96
R6207:L1td1 UTSW 4 98737418 missense possibly damaging 0.55
R6309:L1td1 UTSW 4 98737091 missense probably damaging 0.99
R6917:L1td1 UTSW 4 98734031 missense probably benign 0.18
R6945:L1td1 UTSW 4 98733696 missense probably benign 0.33
R7185:L1td1 UTSW 4 98736618 missense possibly damaging 0.72
R7258:L1td1 UTSW 4 98736864 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGCTTGCACGATTGAGGC -3'
(R):5'- TTTGGTGGACAGAGAGCACTC -3'

Sequencing Primer
(F):5'- TCCAACATCCGAGTGATAGGGATTC -3'
(R):5'- AGCACTCCAGGTTGCTAATG -3'
Posted On2015-10-08