Incidental Mutation 'R4643:Rasal1'
ID351723
Institutional Source Beutler Lab
Gene Symbol Rasal1
Ensembl Gene ENSMUSG00000029602
Gene NameRAS protein activator like 1 (GAP1 like)
SynonymsMRASAL
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120648812-120679597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120678964 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 779 (T779I)
Ref Sequence ENSEMBL: ENSMUSP00000123266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000031607] [ENSMUST00000156722]
Predicted Effect probably benign
Transcript: ENSMUST00000031606
AA Change: T779I

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602
AA Change: T779I

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031607
SMART Domains Protein: ENSMUSP00000031607
Gene: ENSMUSG00000029603

DomainStartEndE-ValueType
WWE 23 102 1.29e-38 SMART
WWE 104 179 3.88e-33 SMART
low complexity region 226 251 N/A INTRINSIC
low complexity region 258 290 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
RING 418 478 5.82e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154759
Predicted Effect probably benign
Transcript: ENSMUST00000156722
AA Change: T779I

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602
AA Change: T779I

DomainStartEndE-ValueType
C2 6 113 7.74e-13 SMART
C2 134 231 2e-15 SMART
RasGAP 241 604 3.96e-166 SMART
PH 566 674 2.76e-16 SMART
BTK 674 710 2.24e-4 SMART
low complexity region 731 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201264
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Rasal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Rasal1 APN 5 120664807 missense probably damaging 1.00
IGL01700:Rasal1 APN 5 120676817 missense probably benign 0.06
IGL01790:Rasal1 APN 5 120670318 missense possibly damaging 0.61
IGL01866:Rasal1 APN 5 120675423 missense probably damaging 1.00
IGL02143:Rasal1 APN 5 120652852 missense probably damaging 1.00
IGL02527:Rasal1 APN 5 120666404 missense probably damaging 0.98
IGL02565:Rasal1 APN 5 120676780 splice site probably benign
IGL02710:Rasal1 APN 5 120666431 missense possibly damaging 0.71
PIT4618001:Rasal1 UTSW 5 120670376 missense probably damaging 0.99
R0270:Rasal1 UTSW 5 120674729 missense probably damaging 0.97
R0281:Rasal1 UTSW 5 120674605 missense probably benign
R0673:Rasal1 UTSW 5 120670384 missense probably benign 0.26
R1227:Rasal1 UTSW 5 120670307 missense probably damaging 0.99
R1475:Rasal1 UTSW 5 120662982 missense possibly damaging 0.55
R1486:Rasal1 UTSW 5 120654852 missense probably damaging 1.00
R1557:Rasal1 UTSW 5 120676849 missense possibly damaging 0.87
R1651:Rasal1 UTSW 5 120652845 nonsense probably null
R1792:Rasal1 UTSW 5 120664756 missense probably benign 0.06
R2148:Rasal1 UTSW 5 120662031 missense probably damaging 0.97
R2964:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2966:Rasal1 UTSW 5 120671620 missense probably damaging 0.99
R2983:Rasal1 UTSW 5 120654862 missense probably benign 0.45
R4090:Rasal1 UTSW 5 120675609 missense possibly damaging 0.95
R4205:Rasal1 UTSW 5 120659563 missense probably benign 0.21
R4979:Rasal1 UTSW 5 120678676 missense probably benign
R5171:Rasal1 UTSW 5 120663764 missense probably benign
R5187:Rasal1 UTSW 5 120675395 missense probably benign 0.13
R5877:Rasal1 UTSW 5 120679070 utr 3 prime probably benign
R5924:Rasal1 UTSW 5 120675517 missense probably damaging 1.00
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6037:Rasal1 UTSW 5 120649501 missense possibly damaging 0.55
R6136:Rasal1 UTSW 5 120675478 missense possibly damaging 0.84
R6159:Rasal1 UTSW 5 120659608 missense probably damaging 1.00
R6292:Rasal1 UTSW 5 120659620 missense probably damaging 0.97
R6548:Rasal1 UTSW 5 120674725 missense probably benign 0.00
X0057:Rasal1 UTSW 5 120664512 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTTCCAGTTCACCAATGGG -3'
(R):5'- ACACAGGACCAGGCTTTGTC -3'

Sequencing Primer
(F):5'- ACCAATGGGACAGTATCCTGGTG -3'
(R):5'- GGCCCCAAGCAGTGAAG -3'
Posted On2015-10-08