Incidental Mutation 'R4643:Slco2b1'
ID351734
Institutional Source Beutler Lab
Gene Symbol Slco2b1
Ensembl Gene ENSMUSG00000030737
Gene Namesolute carrier organic anion transporter family, member 2b1
SynonymsOATP-B, Slc21a9
Accession Numbers

Genbank: NM_175316; MGI: 1351872

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location99657804-99711340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99667007 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 439 (V439M)
Ref Sequence ENSEMBL: ENSMUSP00000102703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032985] [ENSMUST00000107086] [ENSMUST00000107088]
Predicted Effect probably benign
Transcript: ENSMUST00000032985
AA Change: V429M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032985
Gene: ENSMUSG00000030737
AA Change: V429M

DomainStartEndE-ValueType
Pfam:OATP 40 637 9.3e-189 PFAM
Pfam:MFS_1 44 468 1.9e-17 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107086
AA Change: V429M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102701
Gene: ENSMUSG00000030737
AA Change: V429M

DomainStartEndE-ValueType
Pfam:OATP 40 637 9.3e-189 PFAM
Pfam:MFS_1 44 468 1.9e-17 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107088
AA Change: V439M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102703
Gene: ENSMUSG00000030737
AA Change: V439M

DomainStartEndE-ValueType
Pfam:OATP 52 646 3.6e-182 PFAM
Pfam:MFS_1 53 476 2e-17 PFAM
transmembrane domain 650 672 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148972
Predicted Effect probably benign
Transcript: ENSMUST00000154295
SMART Domains Protein: ENSMUSP00000121002
Gene: ENSMUSG00000030737

DomainStartEndE-ValueType
Pfam:OATP 5 166 1.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208024
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the organic anion-transporting polypeptide family of membrane proteins. The protein encoded by this locus may function in regulation of placental uptake of sulfated steroids. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Slco2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Slco2b1 APN 7 99660052 nonsense probably null
IGL00469:Slco2b1 APN 7 99660111 missense probably benign 0.21
IGL02625:Slco2b1 APN 7 99660123 splice site probably null
IGL03164:Slco2b1 APN 7 99685536 missense probably damaging 0.97
3-1:Slco2b1 UTSW 7 99685493 missense probably damaging 1.00
R0076:Slco2b1 UTSW 7 99685501 nonsense probably null
R0370:Slco2b1 UTSW 7 99690437 missense probably damaging 1.00
R0469:Slco2b1 UTSW 7 99661536 missense probably benign 0.30
R0510:Slco2b1 UTSW 7 99661536 missense probably benign 0.30
R1456:Slco2b1 UTSW 7 99664907 missense probably null
R1868:Slco2b1 UTSW 7 99686036 missense probably damaging 1.00
R2046:Slco2b1 UTSW 7 99690479 missense probably damaging 0.98
R4030:Slco2b1 UTSW 7 99682825 missense probably damaging 1.00
R4166:Slco2b1 UTSW 7 99660126 missense probably benign 0.30
R4406:Slco2b1 UTSW 7 99664889 missense probably benign 0.22
R4770:Slco2b1 UTSW 7 99670949 critical splice donor site probably null
R4927:Slco2b1 UTSW 7 99685988 missense probably damaging 0.99
R5033:Slco2b1 UTSW 7 99660049 missense probably benign 0.14
R5166:Slco2b1 UTSW 7 99689013 missense possibly damaging 0.50
R5306:Slco2b1 UTSW 7 99688991 missense possibly damaging 0.79
R5358:Slco2b1 UTSW 7 99660044 missense unknown
R5389:Slco2b1 UTSW 7 99685925 missense probably damaging 0.98
R5874:Slco2b1 UTSW 7 99667094 missense probably benign
R6151:Slco2b1 UTSW 7 99690563 missense possibly damaging 0.46
R6163:Slco2b1 UTSW 7 99688899 missense probably damaging 1.00
R6192:Slco2b1 UTSW 7 99685572 missense probably damaging 1.00
R6489:Slco2b1 UTSW 7 99690555 nonsense probably null
R6651:Slco2b1 UTSW 7 99667169 missense probably benign 0.09
R7135:Slco2b1 UTSW 7 99695063 missense probably null 0.03
R7322:Slco2b1 UTSW 7 99691848 missense not run
R7353:Slco2b1 UTSW 7 99690557 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAAGGGCTTGCATAGGGCTTTG -3'
(R):5'- TGCACCTCATCCATGGTAGC -3'

Sequencing Primer
(F):5'- TAGGAGAGGTAGGTGGCTCACTG -3'
(R):5'- TCATCCATGGTAGCGGGCATG -3'
Posted On2015-10-08