Incidental Mutation 'R4643:Sycp2l'
ID351744
Institutional Source Beutler Lab
Gene Symbol Sycp2l
Ensembl Gene ENSMUSG00000038651
Gene Namesynaptonemal complex protein 2-like
SynonymsEG621792, LOC218175
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4643 (G1)
Quality Score202
Status Not validated
Chromosome13
Chromosomal Location41114307-41174351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41143465 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 341 (M341V)
Ref Sequence ENSEMBL: ENSMUSP00000115127 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000124093
AA Change: M341V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit early reproductive senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Sycp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4531001:Sycp2l UTSW 13 41146672 missense probably null 0.00
R0016:Sycp2l UTSW 13 41157500 intron probably benign
R0024:Sycp2l UTSW 13 41141788 missense probably damaging 1.00
R0024:Sycp2l UTSW 13 41141788 missense probably damaging 1.00
R0099:Sycp2l UTSW 13 41129525 splice site probably benign
R0471:Sycp2l UTSW 13 41150530 splice site probably null
R0582:Sycp2l UTSW 13 41137955 splice site probably benign
R0605:Sycp2l UTSW 13 41143466 missense probably benign 0.22
R1311:Sycp2l UTSW 13 41135185 nonsense probably null
R1999:Sycp2l UTSW 13 41118304 missense probably benign 0.11
R3115:Sycp2l UTSW 13 41148798 missense probably benign 0.41
R3977:Sycp2l UTSW 13 41141964 missense probably damaging 0.99
R3979:Sycp2l UTSW 13 41141964 missense probably damaging 0.99
R5027:Sycp2l UTSW 13 41129771 critical splice acceptor site probably null
R5037:Sycp2l UTSW 13 41129861 missense possibly damaging 0.89
R5780:Sycp2l UTSW 13 41129500 missense possibly damaging 0.61
R6216:Sycp2l UTSW 13 41141724 missense probably damaging 1.00
R7035:Sycp2l UTSW 13 41157497 missense unknown
R7179:Sycp2l UTSW 13 41129782 missense probably damaging 1.00
R7267:Sycp2l UTSW 13 41146594 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CGGCCTCTGAGTCATGTATTTG -3'
(R):5'- CTTCTGCTTGACCAAAGGATAC -3'

Sequencing Primer
(F):5'- CTCTGAGTCATGTATTTGTGTGTATG -3'
(R):5'- GCATGGTAGCACAGGCCTTTAATC -3'
Posted On2015-10-08