Incidental Mutation 'R4643:Kazald1'
ID351754
Institutional Source Beutler Lab
Gene Symbol Kazald1
Ensembl Gene ENSMUSG00000025213
Gene NameKazal-type serine peptidase inhibitor domain 1
SynonymsIgfbp-rp10, Bono1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location45075241-45079289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45078349 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 196 (V196L)
Ref Sequence ENSEMBL: ENSMUSP00000107579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026234] [ENSMUST00000111948]
Predicted Effect probably benign
Transcript: ENSMUST00000026234
AA Change: V196L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026234
Gene: ENSMUSG00000025213
AA Change: V196L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Pfam:IGFBP 60 115 4.4e-7 PFAM
KAZAL 132 175 7.29e-7 SMART
IGc2 191 267 1.06e-11 SMART
low complexity region 299 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111948
AA Change: V196L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107579
Gene: ENSMUSG00000025213
AA Change: V196L

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Pfam:IGFBP 60 115 4.4e-7 PFAM
KAZAL 132 175 7.29e-7 SMART
IGc2 191 267 1.06e-11 SMART
low complexity region 299 308 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted member of the insulin growth factor-binding protein (IGFBP) superfamily. The protein contains an insulin growth factor-binding domain in its N-terminal region, a Kazal-type serine protease inhibitor and follistatin-like domain in its central region, and an immunoglobulin-like domain in its C-terminal region. Studies of the mouse ortholog suggest that this protein may function in bone development and bone regeneration. This gene is hypomethylated and over-expressed in high-grade glioma compared to low-grade glioma, and thus the hypomethylated gene may be associated with cell proliferation and the shorter survival of patients with high-grade glioma. It is also one of numerous genes found to be deleted in a novel 5.54 Mb interstitial deletion, which is associated with multiple congenital anomalies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Kazald1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03347:Kazald1 APN 19 45078416 missense possibly damaging 0.90
R6397:Kazald1 UTSW 19 45076878 missense probably benign 0.03
R7170:Kazald1 UTSW 19 45078416 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CAGATGCATGTTGCCCTTGG -3'
(R):5'- TGAGGTCCACCCCTAAACTG -3'

Sequencing Primer
(F):5'- GGCATGCTTTGTGTCCCGC -3'
(R):5'- CAAGGTCATCTGCAGAAGTCCTG -3'
Posted On2015-10-08