Incidental Mutation 'R4667:Adgra3'
ID352017
Institutional Source Beutler Lab
Gene Symbol Adgra3
Ensembl Gene ENSMUSG00000029090
Gene Nameadhesion G protein-coupled receptor A3
SynonymsGpr125, Tem5-like, 3830613O22Rik
MMRRC Submission 042012-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4667 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location49959956-50059006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49978956 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 729 (Y729F)
Ref Sequence ENSEMBL: ENSMUSP00000030971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030971]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030971
AA Change: Y729F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: Y729F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G T 17: 28,908,313 Q241K possibly damaging Het
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Ago2 A G 15: 73,146,416 Y58H probably damaging Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Akap2 A T 4: 57,855,655 D328V possibly damaging Het
Ankhd1 C A 18: 36,648,021 P2042Q possibly damaging Het
Arhgef15 T C 11: 68,954,561 K155R probably benign Het
Atp10b T C 11: 43,247,518 F1209L probably damaging Het
B130006D01Rik A T 11: 95,726,509 probably benign Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Btbd17 A G 11: 114,793,857 F119L possibly damaging Het
Ccdc191 G T 16: 43,931,283 K267N probably damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Chd9 T C 8: 91,033,800 S2058P possibly damaging Het
Clcn6 T C 4: 148,024,167 E135G possibly damaging Het
Cntn1 T A 15: 92,295,079 N687K probably damaging Het
Col1a2 A T 6: 4,512,412 M99L unknown Het
Cpeb2 T C 5: 43,233,892 probably benign Het
Csn1s2b A G 5: 87,822,311 T134A possibly damaging Het
Cst13 A T 2: 148,823,081 probably benign Het
Cyp2c66 T A 19: 39,176,656 D360E probably damaging Het
Dhx8 A G 11: 101,738,161 S179G unknown Het
Dip2b A G 15: 100,151,360 I212V probably benign Het
Dnah9 G A 11: 66,155,531 H64Y probably benign Het
Dnal1 T C 12: 84,136,700 probably benign Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 I3175V probably benign Het
Elf5 A G 2: 103,449,060 N209D probably damaging Het
Elovl1 A G 4: 118,430,787 Y40C probably damaging Het
Erp27 T C 6: 136,908,152 E216G possibly damaging Het
F5 G A 1: 164,174,186 V153I probably benign Het
Fam186a G A 15: 99,944,532 T1277I possibly damaging Het
Fam90a1a A T 8: 21,963,346 H239L possibly damaging Het
Fchsd2 G T 7: 101,250,449 R334L probably damaging Het
Fermt3 T C 19: 7,002,920 Y369C probably damaging Het
Fhod3 C T 18: 25,066,338 P689S probably benign Het
Fnbp1l G T 3: 122,556,567 Q332K probably benign Het
Frem3 T C 8: 80,663,420 S1767P probably damaging Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gm609 A G 16: 45,444,163 S11P probably benign Het
Gphn T C 12: 78,454,817 S119P probably damaging Het
Herc2 A G 7: 56,131,253 D1222G probably damaging Het
Hmx3 T C 7: 131,544,382 I273T possibly damaging Het
Hnrnpu A G 1: 178,332,181 probably benign Het
Hspg2 C T 4: 137,539,645 T1987I possibly damaging Het
Ighv1-22 T A 12: 114,746,451 Q58L probably damaging Het
Ighv14-3 T A 12: 114,060,255 I7F probably benign Het
Kcns3 C A 12: 11,091,783 R305L probably damaging Het
Kcnu1 C T 8: 25,910,921 A699V possibly damaging Het
Kif22 A C 7: 127,033,328 L270W probably damaging Het
Lrp2 G T 2: 69,489,298 H1960Q probably benign Het
March7 C T 2: 60,241,050 Q94* probably null Het
Mcoln3 A T 3: 146,131,204 I264F probably benign Het
Mdn1 A C 4: 32,679,572 T706P probably damaging Het
Mfsd2b A G 12: 4,867,636 C137R probably benign Het
Mmp25 A G 17: 23,644,607 V83A probably benign Het
Mocos T C 18: 24,666,434 Y242H probably benign Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtus2 T C 5: 148,298,260 S1156P possibly damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mybbp1a G A 11: 72,447,971 E775K possibly damaging Het
Myo10 A G 15: 25,793,153 E1272G possibly damaging Het
Nars A G 18: 64,505,231 S254P possibly damaging Het
Ncapd2 A G 6: 125,184,518 I211T possibly damaging Het
Ncoa7 A T 10: 30,690,790 W582R probably damaging Het
Npr3 T A 15: 11,905,467 D58V possibly damaging Het
Nr3c1 G T 18: 39,428,727 T430K probably benign Het
Odf2l A G 3: 145,128,040 T111A probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfml2a T G 2: 38,949,010 S190A probably damaging Het
Olfr148 T C 9: 39,613,738 M57T probably damaging Het
Olfr243 A G 7: 103,716,638 T15A probably benign Het
Olfr870 T C 9: 20,171,098 I158V probably benign Het
Olfr965 G T 9: 39,719,709 V161F probably benign Het
Optn T C 2: 5,033,139 K415E probably benign Het
Perm1 C A 4: 156,220,206 S803* probably null Het
Pex14 T C 4: 148,984,085 T84A probably benign Het
Pih1d2 T A 9: 50,620,952 Y103* probably null Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Polr1a A G 6: 71,917,821 N171S probably benign Het
Prrx1 A G 1: 163,254,047 S201P probably benign Het
Psme2b A T 11: 48,945,666 N151K probably benign Het
Serpinb5 A T 1: 106,872,295 T72S probably benign Het
Sgsm1 A G 5: 113,260,047 probably null Het
Sipa1l2 T C 8: 125,453,470 R1063G possibly damaging Het
Slc19a3 T C 1: 83,022,799 T166A probably benign Het
Slc5a4b T C 10: 76,075,045 Y319C possibly damaging Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Sult6b2 G T 6: 142,801,695 C109* probably null Het
Tcf25 A G 8: 123,397,025 E467G possibly damaging Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Tmem2 G A 19: 21,797,351 R119H probably benign Het
Tmem2 C T 19: 21,844,781 A1180V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tspan11 T A 6: 127,943,715 C208* probably null Het
Ttc1 A G 11: 43,745,317 V33A probably benign Het
Uck1 T A 2: 32,256,034 H283L probably damaging Het
Utrn A C 10: 12,698,053 V1091G probably benign Het
Vmn1r11 A T 6: 57,137,498 H49L probably damaging Het
Vmn1r160 G T 7: 22,872,053 S277I probably benign Het
Vmn1r18 A T 6: 57,390,084 S162T probably benign Het
Vps37b A G 5: 124,010,732 L80P probably damaging Het
Wfdc3 T C 2: 164,743,086 M1V probably null Het
Wrn A T 8: 33,324,338 N116K probably benign Het
Wscd2 G T 5: 113,577,272 G391V probably damaging Het
Zcchc11 G A 4: 108,495,159 E357K probably damaging Het
Zfp286 A G 11: 62,780,602 V215A probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Other mutations in Adgra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Adgra3 APN 5 50025758 missense probably damaging 1.00
IGL00848:Adgra3 APN 5 50001949 missense probably damaging 1.00
IGL01455:Adgra3 APN 5 49987557 nonsense probably null
IGL01665:Adgra3 APN 5 50006930 missense possibly damaging 0.64
IGL02151:Adgra3 APN 5 49979142 missense probably benign
IGL02239:Adgra3 APN 5 49960712 missense probably damaging 1.00
IGL02351:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02358:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02938:Adgra3 APN 5 49961317 missense probably benign 0.01
IGL03028:Adgra3 APN 5 50016852 missense probably benign 0.30
aperture UTSW 5 49999145 nonsense probably null
saltatory UTSW 5 49960559 missense probably benign 0.09
ANU74:Adgra3 UTSW 5 49961038 missense probably benign 0.16
R0041:Adgra3 UTSW 5 49960559 missense probably benign 0.09
R0121:Adgra3 UTSW 5 50025786 splice site probably benign
R0125:Adgra3 UTSW 5 50001852 splice site probably benign
R0137:Adgra3 UTSW 5 49963840 splice site probably benign
R0415:Adgra3 UTSW 5 49961757 splice site probably benign
R0479:Adgra3 UTSW 5 49990265 missense probably benign 0.00
R0505:Adgra3 UTSW 5 50009334 critical splice donor site probably null
R0831:Adgra3 UTSW 5 49970802 missense probably damaging 1.00
R0883:Adgra3 UTSW 5 49960723 missense probably damaging 1.00
R0920:Adgra3 UTSW 5 49961161 missense probably benign 0.19
R1139:Adgra3 UTSW 5 49961755 splice site probably null
R1211:Adgra3 UTSW 5 50006876 missense possibly damaging 0.88
R1370:Adgra3 UTSW 5 49960787 missense possibly damaging 0.56
R1530:Adgra3 UTSW 5 49961137 missense probably benign 0.00
R1703:Adgra3 UTSW 5 50006775 missense probably benign 0.00
R1782:Adgra3 UTSW 5 49972062 missense probably benign 0.02
R1843:Adgra3 UTSW 5 49961492 missense probably damaging 1.00
R2157:Adgra3 UTSW 5 50001941 missense possibly damaging 0.87
R2281:Adgra3 UTSW 5 50001880 missense probably benign 0.04
R2385:Adgra3 UTSW 5 49979566 missense possibly damaging 0.95
R2426:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R3084:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3086:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3409:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3410:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3411:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R4301:Adgra3 UTSW 5 49961078 missense possibly damaging 0.94
R4360:Adgra3 UTSW 5 49990210 missense possibly damaging 0.92
R4475:Adgra3 UTSW 5 50001898 missense probably damaging 1.00
R4569:Adgra3 UTSW 5 49960563 missense probably damaging 1.00
R4607:Adgra3 UTSW 5 49970739 missense probably damaging 0.98
R4671:Adgra3 UTSW 5 49979368 missense probably damaging 1.00
R4886:Adgra3 UTSW 5 49999195 missense probably benign 0.07
R5197:Adgra3 UTSW 5 49960754 missense probably benign 0.01
R5208:Adgra3 UTSW 5 50011515 missense probably damaging 0.99
R5313:Adgra3 UTSW 5 49961309 missense probably benign 0.24
R5435:Adgra3 UTSW 5 49990126 missense probably damaging 0.99
R5663:Adgra3 UTSW 5 49999285 missense probably benign 0.14
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6064:Adgra3 UTSW 5 49960325 missense probably damaging 0.97
R6259:Adgra3 UTSW 5 49999141 missense possibly damaging 0.63
R6272:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R6293:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6296:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6297:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6352:Adgra3 UTSW 5 49979136 missense probably benign
R6352:Adgra3 UTSW 5 49990250 missense probably benign 0.01
R6989:Adgra3 UTSW 5 50006884 missense probably damaging 1.00
X0065:Adgra3 UTSW 5 49971962 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAAGCACATTCATTTCACTTGG -3'
(R):5'- TTCTCCAGATGGTGCAACCG -3'

Sequencing Primer
(F):5'- ACTTGGTAGTAACTCAATTTCCCTTG -3'
(R):5'- TCCAGATGGTGCAACCGTAGATAC -3'
Posted On2015-10-08