Incidental Mutation 'R0270:Ubr4'
ID35202
Institutional Source Beutler Lab
Gene Symbol Ubr4
Ensembl Gene ENSMUSG00000066036
Gene Nameubiquitin protein ligase E3 component n-recognin 4
SynonymsLOC381562, D930005K06Rik, Zubr1, p600, 1810009A16Rik, A930005E13Rik
MMRRC Submission 038496-MU
Accession Numbers

Ncbi RefSeq: NM_001160319.1; MGI:1916366

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0270 (G1)
Quality Score136
Status Validated
Chromosome4
Chromosomal Location139352609-139489588 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 139479435 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000165860]
Predicted Effect probably benign
Transcript: ENSMUST00000097822
SMART Domains Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1660 1725 1.9e-9 PFAM
Blast:ZnF_C2H2 1966 1991 6e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2502 2540 N/A INTRINSIC
low complexity region 2725 2735 N/A INTRINSIC
low complexity region 2818 2852 N/A INTRINSIC
low complexity region 2887 2905 N/A INTRINSIC
low complexity region 2928 2942 N/A INTRINSIC
low complexity region 2945 2959 N/A INTRINSIC
low complexity region 2966 2986 N/A INTRINSIC
low complexity region 3063 3091 N/A INTRINSIC
low complexity region 3329 3385 N/A INTRINSIC
low complexity region 3776 3788 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4364 5160 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145659
Predicted Effect probably benign
Transcript: ENSMUST00000165860
SMART Domains Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1659 1729 4e-13 PFAM
Blast:ZnF_C2H2 1966 1991 5e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2513 2551 N/A INTRINSIC
low complexity region 2736 2746 N/A INTRINSIC
low complexity region 2863 2881 N/A INTRINSIC
low complexity region 2904 2918 N/A INTRINSIC
low complexity region 2921 2935 N/A INTRINSIC
low complexity region 2942 2962 N/A INTRINSIC
low complexity region 3039 3067 N/A INTRINSIC
low complexity region 3305 3361 N/A INTRINSIC
low complexity region 3752 3764 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4340 5136 N/A PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 96.0%
  • 20x: 93.2%
Validation Efficiency 99% (113/114)
MGI Phenotype Strain: 5286698
Lethality: D1-D5
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,166,176 probably benign Het
4922502D21Rik A T 6: 129,325,608 L152* probably null Het
Abcf3 T A 16: 20,560,168 probably null Het
Acadm C T 3: 153,936,324 M190I possibly damaging Het
Adamtsl3 G A 7: 82,556,824 R739Q probably damaging Het
Ank1 T A 8: 23,088,925 probably benign Het
Ap3b1 T A 13: 94,404,118 probably benign Het
Arhgdib A G 6: 136,926,734 V31A probably damaging Het
Arid4a A G 12: 71,072,632 R342G probably damaging Het
Asic3 C T 5: 24,417,702 L517F probably benign Het
Atxn7l1 C T 12: 33,342,151 P242L possibly damaging Het
AY761185 T A 8: 20,944,600 E37D possibly damaging Het
Babam1 T A 8: 71,398,406 D104E probably damaging Het
Batf A T 12: 85,708,672 T100S probably benign Het
Blcap A T 2: 157,557,977 Y59* probably null Het
Cacnb3 G A 15: 98,642,559 A350T probably damaging Het
Cdk15 T A 1: 59,310,806 V319D probably damaging Het
Cenpf T C 1: 189,650,714 H2661R probably benign Het
Cenpq T C 17: 40,930,050 E106G probably damaging Het
Cfap43 A G 19: 47,797,203 probably benign Het
Cfb G A 17: 34,860,386 S778L possibly damaging Het
Clspn T A 4: 126,573,236 N631K probably damaging Het
Cntn2 T A 1: 132,521,724 T660S probably damaging Het
Cntrob T A 11: 69,311,341 H475L possibly damaging Het
Ddx46 T C 13: 55,674,104 I863T probably benign Het
Dnah11 G A 12: 118,041,013 T2191I probably damaging Het
Dock9 T C 14: 121,575,999 T1703A probably benign Het
Fam13c C T 10: 70,544,513 P424S probably benign Het
Fan1 T C 7: 64,348,871 N968D probably benign Het
Fbxl20 A T 11: 98,098,503 probably benign Het
Fkbp1b A T 12: 4,838,229 probably benign Het
G930045G22Rik T A 6: 50,847,059 noncoding transcript Het
Gm28042 C A 2: 120,041,592 R1008S probably benign Het
Gm6614 T A 6: 141,972,411 I580F possibly damaging Het
Gm8298 T A 3: 59,877,019 N304K probably benign Het
Gon4l G A 3: 88,858,400 S376N probably damaging Het
Gstt3 C A 10: 75,780,915 R15L probably damaging Het
Gtdc1 A T 2: 44,752,174 S73T possibly damaging Het
H2afy G A 13: 56,096,114 probably benign Het
Hhatl A G 9: 121,784,720 S419P probably benign Het
Hirip3 T G 7: 126,863,191 S46R probably damaging Het
Hsf2 A G 10: 57,502,639 T204A probably benign Het
Impg2 G A 16: 56,269,015 E1108K possibly damaging Het
Itgb2l G T 16: 96,422,930 probably benign Het
Itih5 A T 2: 10,251,264 N847I probably benign Het
Kif1a T C 1: 93,054,442 probably benign Het
Klhl1 T A 14: 96,518,344 probably benign Het
Ktn1 T A 14: 47,714,662 D963E probably benign Het
Lclat1 T A 17: 73,240,027 V313E probably benign Het
Lrrn4 T C 2: 132,870,719 S395G probably benign Het
Mbtps1 G A 8: 119,538,117 probably benign Het
Me1 A G 9: 86,596,204 probably benign Het
Mov10 C A 3: 104,795,405 C948F probably benign Het
Mterf1a G A 5: 3,890,990 Q293* probably null Het
Nfkb2 A T 19: 46,311,626 M838L possibly damaging Het
Nhlrc2 T A 19: 56,551,870 L97Q probably damaging Het
Nr6a1 A T 2: 38,739,020 Y331N possibly damaging Het
Nup214 C T 2: 32,034,814 A1785V probably damaging Het
Ogg1 C T 6: 113,329,256 T138I probably benign Het
Olfr1461 A G 19: 13,165,887 Y291C probably damaging Het
Olfr1489 A G 19: 13,633,684 Y191C probably damaging Het
Olfr202 A G 16: 59,283,753 V248A probably damaging Het
Olfr829 T A 9: 18,856,831 Y60N probably damaging Het
Plod2 G T 9: 92,584,521 R178L probably benign Het
Polr3b T A 10: 84,718,475 L1017Q probably benign Het
Postn C A 3: 54,384,550 T724N probably damaging Het
Ppm1l T G 3: 69,317,976 probably benign Het
Prpf8 T G 11: 75,505,249 L1983R probably damaging Het
Psma7 A G 2: 180,039,400 V59A probably benign Het
Qser1 T A 2: 104,788,961 Y502F probably benign Het
Rad50 T C 11: 53,668,025 D1129G probably damaging Het
Rasal1 C A 5: 120,674,729 P606Q probably damaging Het
Rgs6 A G 12: 83,133,689 Y438C probably damaging Het
Rnf180 A G 13: 105,252,266 C73R probably benign Het
Rnf216 T A 5: 143,080,241 I474F possibly damaging Het
Sdha A T 13: 74,332,247 L371Q probably damaging Het
Sdk1 T G 5: 142,084,566 L1162R possibly damaging Het
Sh3rf2 T C 18: 42,104,081 I223T probably damaging Het
Sirpb1a A G 3: 15,410,527 V316A probably damaging Het
Slc12a4 A T 8: 105,945,389 I897N probably benign Het
Slc35d1 A T 4: 103,190,838 V243E probably damaging Het
Slc4a11 T A 2: 130,690,932 K200N possibly damaging Het
Slc9a8 T A 2: 167,451,296 M188K probably damaging Het
Snrnp200 T C 2: 127,232,982 S1492P probably damaging Het
Sphk2 T C 7: 45,710,725 *618W probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tdpoz3 A G 3: 93,826,924 N302S probably benign Het
Tdrd6 T C 17: 43,624,308 M1950V probably benign Het
Tmem39a A G 16: 38,564,313 probably benign Het
Trip4 A T 9: 65,858,358 I353K probably damaging Het
Trip6 A T 5: 137,312,841 F204L probably benign Het
Trpm4 T A 7: 45,319,253 I419F possibly damaging Het
Ttn C A 2: 76,944,796 E1967D probably damaging Het
Uba2 C T 7: 34,150,856 V391M possibly damaging Het
Upf1 G A 8: 70,335,645 probably benign Het
Vmn1r228 A C 17: 20,776,596 V220G possibly damaging Het
Vmn2r79 A G 7: 87,003,386 M429V probably benign Het
Vps36 C T 8: 22,210,456 T210I possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Ybx1 C T 4: 119,281,591 G126D probably benign Het
Yipf5 C A 18: 40,206,407 probably benign Het
Zdhhc5 A C 2: 84,690,115 S573A probably benign Het
Zfp457 A T 13: 67,293,927 C99S probably damaging Het
Zfp52 T A 17: 21,561,302 C471S probably damaging Het
Zfp558 C T 9: 18,467,956 V71I probably damaging Het
Zfp651 A G 9: 121,767,575 T666A probably benign Het
Zfp655 A G 5: 145,244,457 Y375C probably damaging Het
Zfp882 A T 8: 71,914,615 T429S probably benign Het
Zmym2 T C 14: 56,949,684 probably null Het
Other mutations in Ubr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ubr4 APN 4 139465322 missense possibly damaging 0.46
IGL00336:Ubr4 APN 4 139428566 missense probably damaging 1.00
IGL00586:Ubr4 APN 4 139455184 missense possibly damaging 0.95
IGL00659:Ubr4 APN 4 139421245 missense probably damaging 1.00
IGL00766:Ubr4 APN 4 139440766 missense probably damaging 1.00
IGL00819:Ubr4 APN 4 139476282 missense possibly damaging 0.92
IGL00833:Ubr4 APN 4 139393159 critical splice donor site probably null
IGL01126:Ubr4 APN 4 139402555 missense probably benign 0.04
IGL01311:Ubr4 APN 4 139479045 missense possibly damaging 0.66
IGL01349:Ubr4 APN 4 139480728 missense unknown
IGL01388:Ubr4 APN 4 139460243 missense possibly damaging 0.76
IGL01417:Ubr4 APN 4 139410800 missense probably damaging 0.99
IGL01446:Ubr4 APN 4 139438040 splice site probably benign
IGL01449:Ubr4 APN 4 139412736 missense probably damaging 0.98
IGL01545:Ubr4 APN 4 139442829 splice site probably benign
IGL01568:Ubr4 APN 4 139421373 missense probably damaging 1.00
IGL01596:Ubr4 APN 4 139462534 splice site probably benign
IGL01621:Ubr4 APN 4 139440783 nonsense probably null
IGL01639:Ubr4 APN 4 139417344 missense probably damaging 0.99
IGL01655:Ubr4 APN 4 139407796 missense probably damaging 1.00
IGL01710:Ubr4 APN 4 139418461 missense possibly damaging 0.81
IGL01830:Ubr4 APN 4 139472500 missense probably damaging 0.99
IGL01862:Ubr4 APN 4 139477158 missense possibly damaging 0.66
IGL01868:Ubr4 APN 4 139412678 nonsense probably null
IGL01874:Ubr4 APN 4 139393289 splice site probably benign
IGL01889:Ubr4 APN 4 139462472 nonsense probably null
IGL01891:Ubr4 APN 4 139436260 critical splice donor site probably null
IGL01980:Ubr4 APN 4 139429602 missense probably damaging 0.99
IGL02126:Ubr4 APN 4 139452741 critical splice donor site probably null
IGL02153:Ubr4 APN 4 139460160 nonsense probably null
IGL02173:Ubr4 APN 4 139437070 splice site probably null
IGL02214:Ubr4 APN 4 139428583 missense possibly damaging 0.95
IGL02214:Ubr4 APN 4 139461827 critical splice acceptor site probably null
IGL02220:Ubr4 APN 4 139388435 missense probably benign 0.01
IGL02246:Ubr4 APN 4 139459103 missense possibly damaging 0.89
IGL02264:Ubr4 APN 4 139455628 nonsense probably null
IGL02273:Ubr4 APN 4 139472578 missense possibly damaging 0.94
IGL02316:Ubr4 APN 4 139473178 missense possibly damaging 0.46
IGL02328:Ubr4 APN 4 139478922 missense probably damaging 0.97
IGL02476:Ubr4 APN 4 139421249 nonsense probably null
IGL02477:Ubr4 APN 4 139436205 missense probably damaging 0.98
IGL02544:Ubr4 APN 4 139415118 missense probably damaging 1.00
IGL02622:Ubr4 APN 4 139467250 nonsense probably null
IGL02679:Ubr4 APN 4 139459134 missense probably damaging 0.99
IGL02728:Ubr4 APN 4 139468811 missense probably damaging 1.00
IGL02754:Ubr4 APN 4 139410784 missense probably damaging 0.99
IGL02754:Ubr4 APN 4 139393159 critical splice donor site probably null
IGL02892:Ubr4 APN 4 139417331 missense probably damaging 0.96
IGL02897:Ubr4 APN 4 139472508 missense probably damaging 0.97
IGL02946:Ubr4 APN 4 139425295 missense probably damaging 1.00
IGL02964:Ubr4 APN 4 139407820 missense possibly damaging 0.84
IGL03059:Ubr4 APN 4 139480676 missense probably damaging 0.98
IGL03068:Ubr4 APN 4 139409730 missense probably benign 0.02
IGL03087:Ubr4 APN 4 139450357 nonsense probably null
IGL03116:Ubr4 APN 4 139479581 splice site probably benign
IGL03212:Ubr4 APN 4 139409763 missense probably benign 0.13
IGL03228:Ubr4 APN 4 139429598 missense probably damaging 1.00
IGL03292:Ubr4 APN 4 139440435 missense probably damaging 1.00
IGL03388:Ubr4 APN 4 139415032 missense probably damaging 0.98
IGL03393:Ubr4 APN 4 139452678 missense probably damaging 1.00
IGL03409:Ubr4 APN 4 139399929 nonsense probably null
R6648_Ubr4_350 UTSW 4 139452719 nonsense probably null
P0019:Ubr4 UTSW 4 139451781 missense probably damaging 1.00
PIT4544001:Ubr4 UTSW 4 139402560 missense possibly damaging 0.93
R0001:Ubr4 UTSW 4 139451788 missense probably damaging 1.00
R0002:Ubr4 UTSW 4 139390900 missense probably damaging 1.00
R0006:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0006:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0008:Ubr4 UTSW 4 139430176 missense probably damaging 1.00
R0027:Ubr4 UTSW 4 139400393 missense probably damaging 0.99
R0027:Ubr4 UTSW 4 139400393 missense probably damaging 0.99
R0030:Ubr4 UTSW 4 139426793 missense probably damaging 1.00
R0044:Ubr4 UTSW 4 139437058 splice site probably benign
R0044:Ubr4 UTSW 4 139437058 splice site probably benign
R0088:Ubr4 UTSW 4 139440814 missense probably damaging 1.00
R0131:Ubr4 UTSW 4 139464051 missense possibly damaging 0.66
R0184:Ubr4 UTSW 4 139445262 missense probably damaging 1.00
R0219:Ubr4 UTSW 4 139430257 missense possibly damaging 0.64
R0227:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0285:Ubr4 UTSW 4 139440801 missense probably damaging 1.00
R0322:Ubr4 UTSW 4 139422418 missense probably damaging 1.00
R0363:Ubr4 UTSW 4 139391860 missense probably damaging 0.98
R0393:Ubr4 UTSW 4 139410860 splice site probably benign
R0450:Ubr4 UTSW 4 139430223 missense probably benign 0.14
R0504:Ubr4 UTSW 4 139406578 missense probably damaging 1.00
R0504:Ubr4 UTSW 4 139480838 critical splice donor site probably null
R0510:Ubr4 UTSW 4 139430223 missense probably benign 0.14
R0513:Ubr4 UTSW 4 139416875 missense possibly damaging 0.74
R0517:Ubr4 UTSW 4 139392124 missense probably benign 0.00
R0558:Ubr4 UTSW 4 139426902 missense probably benign 0.09
R0617:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R0636:Ubr4 UTSW 4 139436302 intron probably null
R0637:Ubr4 UTSW 4 139399615 missense probably damaging 1.00
R0652:Ubr4 UTSW 4 139401326 missense probably damaging 0.99
R0691:Ubr4 UTSW 4 139423906 missense probably damaging 1.00
R0729:Ubr4 UTSW 4 139485320 missense possibly damaging 0.66
R0735:Ubr4 UTSW 4 139428028 splice site probably null
R0751:Ubr4 UTSW 4 139437198 splice site probably benign
R0789:Ubr4 UTSW 4 139410271 critical splice donor site probably null
R0825:Ubr4 UTSW 4 139479576 critical splice donor site probably null
R0828:Ubr4 UTSW 4 139450553 splice site probably benign
R1052:Ubr4 UTSW 4 139455460 missense possibly damaging 0.83
R1184:Ubr4 UTSW 4 139437198 splice site probably benign
R1222:Ubr4 UTSW 4 139388471 splice site probably null
R1258:Ubr4 UTSW 4 139426914 missense probably damaging 1.00
R1321:Ubr4 UTSW 4 139460123 missense possibly damaging 0.46
R1385:Ubr4 UTSW 4 139402612 missense probably benign 0.00
R1450:Ubr4 UTSW 4 139468028 missense probably damaging 1.00
R1470:Ubr4 UTSW 4 139421226 splice site probably null
R1470:Ubr4 UTSW 4 139421226 splice site probably null
R1474:Ubr4 UTSW 4 139429579 missense probably damaging 1.00
R1479:Ubr4 UTSW 4 139425840 missense possibly damaging 0.95
R1534:Ubr4 UTSW 4 139428151 missense possibly damaging 0.95
R1546:Ubr4 UTSW 4 139416927 nonsense probably null
R1785:Ubr4 UTSW 4 139423945 missense probably damaging 1.00
R1786:Ubr4 UTSW 4 139423945 missense probably damaging 1.00
R1789:Ubr4 UTSW 4 139393053 missense probably damaging 1.00
R1796:Ubr4 UTSW 4 139428596 missense probably benign 0.25
R1800:Ubr4 UTSW 4 139407963 missense probably damaging 0.99
R1801:Ubr4 UTSW 4 139452563 splice site probably null
R1827:Ubr4 UTSW 4 139425697 critical splice acceptor site probably null
R1887:Ubr4 UTSW 4 139455560 missense probably damaging 1.00
R1966:Ubr4 UTSW 4 139451244 critical splice acceptor site probably null
R2010:Ubr4 UTSW 4 139480652 missense possibly damaging 0.92
R2049:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2069:Ubr4 UTSW 4 139479540 missense possibly damaging 0.66
R2114:Ubr4 UTSW 4 139429611 nonsense probably null
R2140:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2141:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2142:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2168:Ubr4 UTSW 4 139410649 missense probably benign 0.25
R2237:Ubr4 UTSW 4 139442790 missense probably damaging 1.00
R2249:Ubr4 UTSW 4 139448921 missense probably damaging 1.00
R2261:Ubr4 UTSW 4 139413462 missense probably damaging 0.99
R2264:Ubr4 UTSW 4 139420373 splice site probably benign
R2353:Ubr4 UTSW 4 139433673 missense possibly damaging 0.48
R2437:Ubr4 UTSW 4 139473542 missense possibly damaging 0.90
R2496:Ubr4 UTSW 4 139473205 unclassified probably benign
R2896:Ubr4 UTSW 4 139455644 splice site probably null
R2922:Ubr4 UTSW 4 139479500 missense possibly damaging 0.66
R2972:Ubr4 UTSW 4 139406536 missense probably benign 0.22
R2973:Ubr4 UTSW 4 139406536 missense probably benign 0.22
R2989:Ubr4 UTSW 4 139463558 missense possibly damaging 0.89
R3176:Ubr4 UTSW 4 139421855 missense probably benign 0.03
R3276:Ubr4 UTSW 4 139421855 missense probably benign 0.03
R3772:Ubr4 UTSW 4 139452700 missense possibly damaging 0.89
R3844:Ubr4 UTSW 4 139459126 missense probably damaging 0.99
R3873:Ubr4 UTSW 4 139423990 missense probably damaging 1.00
R3900:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R3951:Ubr4 UTSW 4 139393094 missense probably damaging 1.00
R4020:Ubr4 UTSW 4 139451805 missense probably damaging 0.98
R4178:Ubr4 UTSW 4 139393414 missense probably damaging 1.00
R4308:Ubr4 UTSW 4 139472509 missense possibly damaging 0.46
R4378:Ubr4 UTSW 4 139410440 missense possibly damaging 0.76
R4400:Ubr4 UTSW 4 139461856 missense possibly damaging 0.66
R4421:Ubr4 UTSW 4 139461856 missense possibly damaging 0.66
R4462:Ubr4 UTSW 4 139418502 missense possibly damaging 0.47
R4583:Ubr4 UTSW 4 139380853 missense possibly damaging 0.82
R4611:Ubr4 UTSW 4 139399579 missense possibly damaging 0.93
R4664:Ubr4 UTSW 4 139406518 missense possibly damaging 0.56
R4671:Ubr4 UTSW 4 139436191 missense possibly damaging 0.66
R4672:Ubr4 UTSW 4 139410716 missense probably damaging 0.99
R4673:Ubr4 UTSW 4 139410716 missense probably damaging 0.99
R4696:Ubr4 UTSW 4 139408672 missense probably benign 0.09
R4701:Ubr4 UTSW 4 139471336 missense possibly damaging 0.66
R4705:Ubr4 UTSW 4 139450529 missense probably damaging 1.00
R4726:Ubr4 UTSW 4 139482579 missense possibly damaging 0.46
R4728:Ubr4 UTSW 4 139423879 missense probably damaging 1.00
R4783:Ubr4 UTSW 4 139421733 missense possibly damaging 0.85
R4833:Ubr4 UTSW 4 139402546 missense probably damaging 0.98
R4892:Ubr4 UTSW 4 139428517 missense probably benign 0.14
R4936:Ubr4 UTSW 4 139396566 missense probably damaging 0.98
R5000:Ubr4 UTSW 4 139436169 missense probably damaging 0.98
R5114:Ubr4 UTSW 4 139410623 missense probably damaging 0.99
R5189:Ubr4 UTSW 4 139410649 missense probably benign 0.25
R5197:Ubr4 UTSW 4 139468097 missense probably damaging 1.00
R5213:Ubr4 UTSW 4 139402566 nonsense probably null
R5219:Ubr4 UTSW 4 139477232 nonsense probably null
R5346:Ubr4 UTSW 4 139428491 missense probably damaging 0.97
R5368:Ubr4 UTSW 4 139397528 intron probably benign
R5442:Ubr4 UTSW 4 139407772 missense probably damaging 1.00
R5527:Ubr4 UTSW 4 139480788 missense possibly damaging 0.83
R5548:Ubr4 UTSW 4 139460090 missense probably damaging 0.97
R5568:Ubr4 UTSW 4 139392038 missense probably damaging 0.99
R5639:Ubr4 UTSW 4 139452648 missense possibly damaging 0.66
R5643:Ubr4 UTSW 4 139444687 missense probably damaging 1.00
R5663:Ubr4 UTSW 4 139428583 missense possibly damaging 0.95
R5755:Ubr4 UTSW 4 139460095 missense possibly damaging 0.66
R5781:Ubr4 UTSW 4 139468096 missense probably damaging 1.00
R5784:Ubr4 UTSW 4 139425218 missense probably damaging 1.00
R5817:Ubr4 UTSW 4 139468847 missense probably damaging 1.00
R5872:Ubr4 UTSW 4 139425330 missense probably damaging 0.98
R5891:Ubr4 UTSW 4 139408626 nonsense probably null
R5901:Ubr4 UTSW 4 139451254 missense probably damaging 1.00
R5958:Ubr4 UTSW 4 139455638 missense probably damaging 1.00
R5974:Ubr4 UTSW 4 139421078 splice site probably null
R6065:Ubr4 UTSW 4 139421238 missense probably damaging 1.00
R6109:Ubr4 UTSW 4 139417364 missense probably damaging 0.99
R6207:Ubr4 UTSW 4 139421248 missense probably damaging 1.00
R6265:Ubr4 UTSW 4 139452640 missense possibly damaging 0.90
R6319:Ubr4 UTSW 4 139408889 missense possibly damaging 0.84
R6342:Ubr4 UTSW 4 139429539 missense possibly damaging 0.88
R6434:Ubr4 UTSW 4 139429638 missense probably damaging 1.00
R6437:Ubr4 UTSW 4 139397214 critical splice donor site probably null
R6481:Ubr4 UTSW 4 139431751 missense probably damaging 0.97
R6502:Ubr4 UTSW 4 139444671 missense probably damaging 1.00
R6546:Ubr4 UTSW 4 139414394 missense probably damaging 0.99
R6603:Ubr4 UTSW 4 139455586 missense probably benign 0.17
R6648:Ubr4 UTSW 4 139452719 nonsense probably null
R6649:Ubr4 UTSW 4 139473624 missense possibly damaging 0.66
R6653:Ubr4 UTSW 4 139473624 missense possibly damaging 0.66
R6668:Ubr4 UTSW 4 139465341 missense probably damaging 1.00
R6770:Ubr4 UTSW 4 139489182 missense unknown
R6772:Ubr4 UTSW 4 139467230 nonsense probably null
R6857:Ubr4 UTSW 4 139486051 missense possibly damaging 0.90
R6869:Ubr4 UTSW 4 139467227 missense possibly damaging 0.93
R6912:Ubr4 UTSW 4 139458234 critical splice donor site probably null
R6943:Ubr4 UTSW 4 139437131 nonsense probably null
R6970:Ubr4 UTSW 4 139406528 nonsense probably null
R6976:Ubr4 UTSW 4 139393077 missense probably damaging 0.98
R7000:Ubr4 UTSW 4 139414404 missense probably damaging 1.00
R7017:Ubr4 UTSW 4 139393090 missense probably damaging 0.99
R7165:Ubr4 UTSW 4 139450513 missense
R7222:Ubr4 UTSW 4 139463373 missense unknown
R7241:Ubr4 UTSW 4 139443414 missense probably damaging 1.00
R7343:Ubr4 UTSW 4 139413438 missense probably benign 0.09
R7367:Ubr4 UTSW 4 139452691 missense unknown
R7393:Ubr4 UTSW 4 139426785 missense probably damaging 1.00
R7432:Ubr4 UTSW 4 139388382 missense probably damaging 1.00
R7448:Ubr4 UTSW 4 139462467 missense unknown
R7502:Ubr4 UTSW 4 139412672 missense possibly damaging 0.72
R7514:Ubr4 UTSW 4 139452655 missense unknown
R7526:Ubr4 UTSW 4 139422417 missense probably benign 0.00
R7529:Ubr4 UTSW 4 139422417 missense probably benign 0.00
T0975:Ubr4 UTSW 4 139451781 missense probably damaging 1.00
X0028:Ubr4 UTSW 4 139410271 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCTGCTTGCCTGAGCTAATGAAG -3'
(R):5'- GGCCCTAAGGACATGGCACATTTAC -3'

Sequencing Primer
(F):5'- CCTGAGCTAATGAAGCATTGAC -3'
(R):5'- AGACATGGATGCCACGTCTTC -3'
Posted On2013-05-09