Incidental Mutation 'R4667:Sipa1l2'
ID352048
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 042012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R4667 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125453470 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1063 (R1063G)
Ref Sequence ENSEMBL: ENSMUSP00000148557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108775
AA Change: R1063G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: R1063G

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212168
AA Change: R1063G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212987
AA Change: R1063G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G T 17: 28,908,313 Q241K possibly damaging Het
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Adgra3 T A 5: 49,978,956 Y729F possibly damaging Het
Ago2 A G 15: 73,146,416 Y58H probably damaging Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Akap2 A T 4: 57,855,655 D328V possibly damaging Het
Ankhd1 C A 18: 36,648,021 P2042Q possibly damaging Het
Arhgef15 T C 11: 68,954,561 K155R probably benign Het
Atp10b T C 11: 43,247,518 F1209L probably damaging Het
B130006D01Rik A T 11: 95,726,509 probably benign Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Btbd17 A G 11: 114,793,857 F119L possibly damaging Het
Ccdc191 G T 16: 43,931,283 K267N probably damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Chd9 T C 8: 91,033,800 S2058P possibly damaging Het
Clcn6 T C 4: 148,024,167 E135G possibly damaging Het
Cntn1 T A 15: 92,295,079 N687K probably damaging Het
Col1a2 A T 6: 4,512,412 M99L unknown Het
Cpeb2 T C 5: 43,233,892 probably benign Het
Csn1s2b A G 5: 87,822,311 T134A possibly damaging Het
Cst13 A T 2: 148,823,081 probably benign Het
Cyp2c66 T A 19: 39,176,656 D360E probably damaging Het
Dhx8 A G 11: 101,738,161 S179G unknown Het
Dip2b A G 15: 100,151,360 I212V probably benign Het
Dnah9 G A 11: 66,155,531 H64Y probably benign Het
Dnal1 T C 12: 84,136,700 probably benign Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 I3175V probably benign Het
Elf5 A G 2: 103,449,060 N209D probably damaging Het
Elovl1 A G 4: 118,430,787 Y40C probably damaging Het
Erp27 T C 6: 136,908,152 E216G possibly damaging Het
F5 G A 1: 164,174,186 V153I probably benign Het
Fam186a G A 15: 99,944,532 T1277I possibly damaging Het
Fam90a1a A T 8: 21,963,346 H239L possibly damaging Het
Fchsd2 G T 7: 101,250,449 R334L probably damaging Het
Fermt3 T C 19: 7,002,920 Y369C probably damaging Het
Fhod3 C T 18: 25,066,338 P689S probably benign Het
Fnbp1l G T 3: 122,556,567 Q332K probably benign Het
Frem3 T C 8: 80,663,420 S1767P probably damaging Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gm609 A G 16: 45,444,163 S11P probably benign Het
Gphn T C 12: 78,454,817 S119P probably damaging Het
Herc2 A G 7: 56,131,253 D1222G probably damaging Het
Hmx3 T C 7: 131,544,382 I273T possibly damaging Het
Hnrnpu A G 1: 178,332,181 probably benign Het
Hspg2 C T 4: 137,539,645 T1987I possibly damaging Het
Ighv1-22 T A 12: 114,746,451 Q58L probably damaging Het
Ighv14-3 T A 12: 114,060,255 I7F probably benign Het
Kcns3 C A 12: 11,091,783 R305L probably damaging Het
Kcnu1 C T 8: 25,910,921 A699V possibly damaging Het
Kif22 A C 7: 127,033,328 L270W probably damaging Het
Lrp2 G T 2: 69,489,298 H1960Q probably benign Het
March7 C T 2: 60,241,050 Q94* probably null Het
Mcoln3 A T 3: 146,131,204 I264F probably benign Het
Mdn1 A C 4: 32,679,572 T706P probably damaging Het
Mfsd2b A G 12: 4,867,636 C137R probably benign Het
Mmp25 A G 17: 23,644,607 V83A probably benign Het
Mocos T C 18: 24,666,434 Y242H probably benign Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtus2 T C 5: 148,298,260 S1156P possibly damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mybbp1a G A 11: 72,447,971 E775K possibly damaging Het
Myo10 A G 15: 25,793,153 E1272G possibly damaging Het
Nars A G 18: 64,505,231 S254P possibly damaging Het
Ncapd2 A G 6: 125,184,518 I211T possibly damaging Het
Ncoa7 A T 10: 30,690,790 W582R probably damaging Het
Npr3 T A 15: 11,905,467 D58V possibly damaging Het
Nr3c1 G T 18: 39,428,727 T430K probably benign Het
Odf2l A G 3: 145,128,040 T111A probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfml2a T G 2: 38,949,010 S190A probably damaging Het
Olfr148 T C 9: 39,613,738 M57T probably damaging Het
Olfr243 A G 7: 103,716,638 T15A probably benign Het
Olfr870 T C 9: 20,171,098 I158V probably benign Het
Olfr965 G T 9: 39,719,709 V161F probably benign Het
Optn T C 2: 5,033,139 K415E probably benign Het
Perm1 C A 4: 156,220,206 S803* probably null Het
Pex14 T C 4: 148,984,085 T84A probably benign Het
Pih1d2 T A 9: 50,620,952 Y103* probably null Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Polr1a A G 6: 71,917,821 N171S probably benign Het
Prrx1 A G 1: 163,254,047 S201P probably benign Het
Psme2b A T 11: 48,945,666 N151K probably benign Het
Serpinb5 A T 1: 106,872,295 T72S probably benign Het
Sgsm1 A G 5: 113,260,047 probably null Het
Slc19a3 T C 1: 83,022,799 T166A probably benign Het
Slc5a4b T C 10: 76,075,045 Y319C possibly damaging Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Sult6b2 G T 6: 142,801,695 C109* probably null Het
Tcf25 A G 8: 123,397,025 E467G possibly damaging Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Tmem2 G A 19: 21,797,351 R119H probably benign Het
Tmem2 C T 19: 21,844,781 A1180V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tspan11 T A 6: 127,943,715 C208* probably null Het
Ttc1 A G 11: 43,745,317 V33A probably benign Het
Uck1 T A 2: 32,256,034 H283L probably damaging Het
Utrn A C 10: 12,698,053 V1091G probably benign Het
Vmn1r11 A T 6: 57,137,498 H49L probably damaging Het
Vmn1r160 G T 7: 22,872,053 S277I probably benign Het
Vmn1r18 A T 6: 57,390,084 S162T probably benign Het
Vps37b A G 5: 124,010,732 L80P probably damaging Het
Wfdc3 T C 2: 164,743,086 M1V probably null Het
Wrn A T 8: 33,324,338 N116K probably benign Het
Wscd2 G T 5: 113,577,272 G391V probably damaging Het
Zcchc11 G A 4: 108,495,159 E357K probably damaging Het
Zfp286 A G 11: 62,780,602 V215A probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTACCTGGTGCCATCAG -3'
(R):5'- GTAAGGTGCCATCCTGTTAGG -3'

Sequencing Primer
(F):5'- TCAGGCAGCTTCCTATCAAAG -3'
(R):5'- AGAGTCTGCTCCGCCATGAG -3'
Posted On2015-10-08