Incidental Mutation 'R4668:Zfp335'
ID352123
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4668 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 164900286 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 593 (C593S)
Ref Sequence ENSEMBL: ENSMUSP00000139133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]
Predicted Effect probably damaging
Transcript: ENSMUST00000041361
AA Change: C593S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: C593S

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139247
SMART Domains Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183830
AA Change: C593S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834
AA Change: C593S

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A T 9: 114,304,711 noncoding transcript Het
6430548M08Rik T C 8: 120,160,414 probably null Het
Abca4 G A 3: 122,155,299 G531E possibly damaging Het
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Acot10 T C 15: 20,665,942 S238G probably benign Het
Adamtsl2 A T 2: 27,095,475 H457L probably benign Het
Ankrd35 A T 3: 96,679,208 T67S probably damaging Het
Aox2 T G 1: 58,334,694 I838S possibly damaging Het
Arnt2 T C 7: 84,275,386 N411S probably damaging Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Carns1 A T 19: 4,165,476 Y902* probably null Het
Cavin1 T C 11: 100,958,796 E336G probably damaging Het
Cbl A T 9: 44,153,848 C728S probably benign Het
Ccdc136 C A 6: 29,411,281 Q218K probably damaging Het
Cdk19 C A 10: 40,466,710 T196K probably damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Ces3a A C 8: 105,053,423 K299T probably damaging Het
Cfap61 A T 2: 146,143,136 I967F probably damaging Het
Cnksr1 C T 4: 134,232,971 probably benign Het
Cped1 T C 6: 22,237,653 Y923H probably benign Het
Crip3 T C 17: 46,429,364 L30P probably damaging Het
Csmd1 A G 8: 16,023,891 I2030T possibly damaging Het
Ctse C A 1: 131,662,749 P70T probably damaging Het
Cyp2b23 A G 7: 26,672,734 F429L probably damaging Het
Cyp2c66 T A 19: 39,176,656 D360E probably damaging Het
D8Ertd738e A T 8: 84,249,481 L46* probably null Het
Dcp2 T A 18: 44,415,362 probably null Het
Ddx10 C A 9: 53,099,213 D834Y possibly damaging Het
Ddx19a A T 8: 110,979,084 V245E probably damaging Het
Dpf2 A C 19: 5,904,487 D130E probably benign Het
Emc8 A T 8: 120,667,779 M67K probably damaging Het
Ephb6 T C 6: 41,614,602 L231P possibly damaging Het
Erp27 T C 6: 136,908,152 E216G possibly damaging Het
Esco1 A T 18: 10,594,734 I184N possibly damaging Het
Fam205c A G 4: 42,871,608 F256L probably benign Het
Fdxacb1 T A 9: 50,770,260 D11E possibly damaging Het
Fhod3 C T 18: 25,066,338 P689S probably benign Het
Fnip1 T A 11: 54,503,559 S940R probably damaging Het
Ganc G T 2: 120,431,067 V343F probably benign Het
Gldn T A 9: 54,332,018 L228* probably null Het
Gm1123 C T 9: 99,009,373 R341H probably damaging Het
Gtf2f2 T C 14: 75,917,638 Y161C probably benign Het
Gtf3c1 T C 7: 125,667,338 T979A probably damaging Het
Hist1h4a A G 13: 23,760,976 V61A probably benign Het
Hmcn2 G T 2: 31,435,792 R4277L probably benign Het
Hsd17b6 T A 10: 127,994,426 probably null Het
Igkv12-46 T C 6: 69,764,797 T25A probably damaging Het
Inpp5e G A 2: 26,400,994 R354C probably damaging Het
Jcad T A 18: 4,680,221 probably null Het
Kcna10 G T 3: 107,194,694 A214S possibly damaging Het
Kit T C 5: 75,641,220 probably null Het
Kmt2a G A 9: 44,824,572 probably benign Het
Lama1 T C 17: 67,752,434 V604A probably benign Het
Mesd T C 7: 83,895,756 V138A probably damaging Het
Mmp13 T C 9: 7,272,580 F9S possibly damaging Het
Mocos T C 18: 24,666,434 Y242H probably benign Het
Mrc1 A C 2: 14,293,486 T718P probably damaging Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Myh10 A G 11: 68,804,642 K1532E probably damaging Het
Nat9 T C 11: 115,184,542 N91S probably damaging Het
Neto2 A T 8: 85,641,062 I351N probably damaging Het
Nfx1 A G 4: 40,976,367 N14D possibly damaging Het
Nlrp4b A G 7: 10,714,733 T288A possibly damaging Het
Nutm2 C A 13: 50,472,997 T396K probably benign Het
Ogdhl A G 14: 32,332,536 T196A probably benign Het
Olfr1453 A T 19: 13,028,081 F83I probably benign Het
Olfr548-ps1 A G 7: 102,542,604 I223V possibly damaging Het
Olfr582 A T 7: 103,041,851 D119V probably benign Het
Omg T A 11: 79,502,423 N203I probably damaging Het
Pdgfrb A G 18: 61,064,113 Y207C probably damaging Het
Pdzd7 T A 19: 45,045,687 probably benign Het
Pgs1 C A 11: 118,003,507 H157N probably damaging Het
Pik3c2a A G 7: 116,358,688 V1121A probably benign Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Pms1 G A 1: 53,189,474 Q872* probably null Het
Ptgs2 A G 1: 150,101,084 T23A probably benign Het
Rgl1 T G 1: 152,521,371 R716S probably damaging Het
Rif1 A G 2: 52,111,952 E1806G probably benign Het
Ripor1 T C 8: 105,614,652 V39A probably benign Het
Ryr2 G T 13: 11,593,117 T868N probably benign Het
Sec22b A T 3: 97,921,122 D167V probably damaging Het
Sec24d T C 3: 123,355,774 V810A probably damaging Het
Shh T C 5: 28,457,855 *438W probably null Het
Slc25a12 G A 2: 71,315,062 S178L probably benign Het
Sorl1 A T 9: 41,984,508 W1784R probably damaging Het
Sp3 A T 2: 72,970,981 S229R probably damaging Het
Spdye4c G A 2: 128,592,353 V5I possibly damaging Het
Spint2 A T 7: 29,260,379 V53D probably damaging Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Stk25 A G 1: 93,625,483 S299P probably damaging Het
Sult2a3 A G 7: 14,122,861 S45P probably damaging Het
Thsd7a A T 6: 12,408,968 V685E probably damaging Het
Tm9sf4 T A 2: 153,187,308 V92D probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Topors G A 4: 40,262,669 T205I probably damaging Het
Tpo T A 12: 30,103,290 Y355F probably benign Het
Uba1y T A Y: 826,032 M396K possibly damaging Het
Vmn1r50 A T 6: 90,107,531 Q86L probably benign Het
Vmn1r77 A G 7: 12,041,431 K45E probably damaging Het
Vmn2r114 A C 17: 23,310,473 N218K possibly damaging Het
Vmn2r66 T A 7: 84,994,697 N835I probably damaging Het
Vps54 T G 11: 21,299,989 N458K probably benign Het
Zcchc7 G T 4: 44,895,964 C304F probably damaging Het
Zmynd15 C G 11: 70,462,588 P214R probably damaging Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTTTCTCCCTAACCCATGGAC -3'
(R):5'- TTTCCTAGAAAGAAGAGGCCGG -3'

Sequencing Primer
(F):5'- TGGACCTCCAGTGGGGAC -3'
(R):5'- ATCCGGTGAGTGTGGACC -3'
Posted On2015-10-08