Incidental Mutation 'R4668:Sorl1'
ID352168
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R4668 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41984508 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1784 (W1784R)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: W1784R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: W1784R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148800
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik A T 9: 114,304,711 noncoding transcript Het
6430548M08Rik T C 8: 120,160,414 probably null Het
Abca4 G A 3: 122,155,299 G531E possibly damaging Het
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Acot10 T C 15: 20,665,942 S238G probably benign Het
Adamtsl2 A T 2: 27,095,475 H457L probably benign Het
Ankrd35 A T 3: 96,679,208 T67S probably damaging Het
Aox2 T G 1: 58,334,694 I838S possibly damaging Het
Arnt2 T C 7: 84,275,386 N411S probably damaging Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Carns1 A T 19: 4,165,476 Y902* probably null Het
Cavin1 T C 11: 100,958,796 E336G probably damaging Het
Cbl A T 9: 44,153,848 C728S probably benign Het
Ccdc136 C A 6: 29,411,281 Q218K probably damaging Het
Cdk19 C A 10: 40,466,710 T196K probably damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Ces3a A C 8: 105,053,423 K299T probably damaging Het
Cfap61 A T 2: 146,143,136 I967F probably damaging Het
Cnksr1 C T 4: 134,232,971 probably benign Het
Cped1 T C 6: 22,237,653 Y923H probably benign Het
Crip3 T C 17: 46,429,364 L30P probably damaging Het
Csmd1 A G 8: 16,023,891 I2030T possibly damaging Het
Ctse C A 1: 131,662,749 P70T probably damaging Het
Cyp2b23 A G 7: 26,672,734 F429L probably damaging Het
Cyp2c66 T A 19: 39,176,656 D360E probably damaging Het
D8Ertd738e A T 8: 84,249,481 L46* probably null Het
Dcp2 T A 18: 44,415,362 probably null Het
Ddx10 C A 9: 53,099,213 D834Y possibly damaging Het
Ddx19a A T 8: 110,979,084 V245E probably damaging Het
Dpf2 A C 19: 5,904,487 D130E probably benign Het
Emc8 A T 8: 120,667,779 M67K probably damaging Het
Ephb6 T C 6: 41,614,602 L231P possibly damaging Het
Erp27 T C 6: 136,908,152 E216G possibly damaging Het
Esco1 A T 18: 10,594,734 I184N possibly damaging Het
Fam205c A G 4: 42,871,608 F256L probably benign Het
Fdxacb1 T A 9: 50,770,260 D11E possibly damaging Het
Fhod3 C T 18: 25,066,338 P689S probably benign Het
Fnip1 T A 11: 54,503,559 S940R probably damaging Het
Ganc G T 2: 120,431,067 V343F probably benign Het
Gldn T A 9: 54,332,018 L228* probably null Het
Gm1123 C T 9: 99,009,373 R341H probably damaging Het
Gtf2f2 T C 14: 75,917,638 Y161C probably benign Het
Gtf3c1 T C 7: 125,667,338 T979A probably damaging Het
Hist1h4a A G 13: 23,760,976 V61A probably benign Het
Hmcn2 G T 2: 31,435,792 R4277L probably benign Het
Hsd17b6 T A 10: 127,994,426 probably null Het
Igkv12-46 T C 6: 69,764,797 T25A probably damaging Het
Inpp5e G A 2: 26,400,994 R354C probably damaging Het
Jcad T A 18: 4,680,221 probably null Het
Kcna10 G T 3: 107,194,694 A214S possibly damaging Het
Kit T C 5: 75,641,220 probably null Het
Kmt2a G A 9: 44,824,572 probably benign Het
Lama1 T C 17: 67,752,434 V604A probably benign Het
Mesd T C 7: 83,895,756 V138A probably damaging Het
Mmp13 T C 9: 7,272,580 F9S possibly damaging Het
Mocos T C 18: 24,666,434 Y242H probably benign Het
Mrc1 A C 2: 14,293,486 T718P probably damaging Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Myh10 A G 11: 68,804,642 K1532E probably damaging Het
Nat9 T C 11: 115,184,542 N91S probably damaging Het
Neto2 A T 8: 85,641,062 I351N probably damaging Het
Nfx1 A G 4: 40,976,367 N14D possibly damaging Het
Nlrp4b A G 7: 10,714,733 T288A possibly damaging Het
Nutm2 C A 13: 50,472,997 T396K probably benign Het
Ogdhl A G 14: 32,332,536 T196A probably benign Het
Olfr1453 A T 19: 13,028,081 F83I probably benign Het
Olfr548-ps1 A G 7: 102,542,604 I223V possibly damaging Het
Olfr582 A T 7: 103,041,851 D119V probably benign Het
Omg T A 11: 79,502,423 N203I probably damaging Het
Pdgfrb A G 18: 61,064,113 Y207C probably damaging Het
Pdzd7 T A 19: 45,045,687 probably benign Het
Pgs1 C A 11: 118,003,507 H157N probably damaging Het
Pik3c2a A G 7: 116,358,688 V1121A probably benign Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Pms1 G A 1: 53,189,474 Q872* probably null Het
Ptgs2 A G 1: 150,101,084 T23A probably benign Het
Rgl1 T G 1: 152,521,371 R716S probably damaging Het
Rif1 A G 2: 52,111,952 E1806G probably benign Het
Ripor1 T C 8: 105,614,652 V39A probably benign Het
Ryr2 G T 13: 11,593,117 T868N probably benign Het
Sec22b A T 3: 97,921,122 D167V probably damaging Het
Sec24d T C 3: 123,355,774 V810A probably damaging Het
Shh T C 5: 28,457,855 *438W probably null Het
Slc25a12 G A 2: 71,315,062 S178L probably benign Het
Sp3 A T 2: 72,970,981 S229R probably damaging Het
Spdye4c G A 2: 128,592,353 V5I possibly damaging Het
Spint2 A T 7: 29,260,379 V53D probably damaging Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Stk25 A G 1: 93,625,483 S299P probably damaging Het
Sult2a3 A G 7: 14,122,861 S45P probably damaging Het
Thsd7a A T 6: 12,408,968 V685E probably damaging Het
Tm9sf4 T A 2: 153,187,308 V92D probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Topors G A 4: 40,262,669 T205I probably damaging Het
Tpo T A 12: 30,103,290 Y355F probably benign Het
Uba1y T A Y: 826,032 M396K possibly damaging Het
Vmn1r50 A T 6: 90,107,531 Q86L probably benign Het
Vmn1r77 A G 7: 12,041,431 K45E probably damaging Het
Vmn2r114 A C 17: 23,310,473 N218K possibly damaging Het
Vmn2r66 T A 7: 84,994,697 N835I probably damaging Het
Vps54 T G 11: 21,299,989 N458K probably benign Het
Zcchc7 G T 4: 44,895,964 C304F probably damaging Het
Zfp335 A T 2: 164,900,286 C593S probably damaging Het
Zmynd15 C G 11: 70,462,588 P214R probably damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAATGGGCAAGGACTGTC -3'
(R):5'- CTGAGATAGCCCATTAACGCCC -3'

Sequencing Primer
(F):5'- CTCAATGGGCAAGGACTGTCTATATG -3'
(R):5'- GCCCACTTACTATAAATAACTGCAG -3'
Posted On2015-10-08