Incidental Mutation 'R4669:Rgl1'
ID352219
Institutional Source Beutler Lab
Gene Symbol Rgl1
Ensembl Gene ENSMUSG00000026482
Gene Nameral guanine nucleotide dissociation stimulator,-like 1
SynonymsRgl
MMRRC Submission 041925-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4669 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location152516760-152766351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 152521371 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 716 (R716S)
Ref Sequence ENSEMBL: ENSMUSP00000107490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859]
Predicted Effect probably damaging
Transcript: ENSMUST00000027760
AA Change: R681S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: R681S

DomainStartEndE-ValueType
RasGEFN 64 196 5.86e-39 SMART
RasGEF 228 502 9.56e-116 SMART
Blast:RasGEF 522 582 6e-8 BLAST
low complexity region 585 596 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
RA 648 735 1.7e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111857
AA Change: R679S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: R679S

DomainStartEndE-ValueType
RasGEFN 62 194 5.86e-39 SMART
RasGEF 226 500 9.56e-116 SMART
Blast:RasGEF 520 580 7e-8 BLAST
low complexity region 583 594 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
RA 646 733 1.7e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111859
AA Change: R716S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: R716S

DomainStartEndE-ValueType
RasGEFN 99 231 5.86e-39 SMART
RasGEF 263 537 9.56e-116 SMART
Blast:RasGEF 557 617 6e-8 BLAST
low complexity region 620 631 N/A INTRINSIC
low complexity region 662 672 N/A INTRINSIC
RA 683 770 1.7e-25 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Acan A G 7: 79,101,142 E464G probably benign Het
Agap1 A G 1: 89,837,806 probably null Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Ap2a1 A T 7: 44,902,919 probably benign Het
Arap3 T C 18: 37,996,254 D217G probably benign Het
Arl2 C A 19: 6,134,686 R179L probably damaging Het
Atg2a T A 19: 6,258,987 probably null Het
B3gat1 T A 9: 26,751,756 L6Q probably benign Het
Bcl10 A G 3: 145,930,572 N75S probably damaging Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Brms1l A G 12: 55,841,571 E48G possibly damaging Het
C2cd2l A T 9: 44,315,025 N414K possibly damaging Het
Capn2 C T 1: 182,470,780 C640Y probably benign Het
Ccdc153 G T 9: 44,245,724 R99M probably damaging Het
Ccdc51 A G 9: 109,090,962 N142S probably benign Het
Ccdc58 A G 16: 36,082,719 D27G probably damaging Het
Cdipt A G 7: 126,978,406 H108R possibly damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Cts3 C T 13: 61,566,823 E223K probably benign Het
Cyp2a22 T C 7: 26,937,855 D168G possibly damaging Het
Cyp2c67 T A 19: 39,643,654 H90L probably benign Het
Ddx4 T C 13: 112,622,244 Y261C probably damaging Het
Dnah17 T C 11: 118,074,293 T2308A probably benign Het
Dnah6 T C 6: 73,037,688 T3587A probably damaging Het
Dpy19l1 C T 9: 24,432,368 V494I possibly damaging Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Emilin3 T C 2: 160,910,797 I78V probably benign Het
Esam T A 9: 37,536,656 Y195* probably null Het
Extl3 T A 14: 65,076,296 N479I possibly damaging Het
Fat2 A G 11: 55,311,615 V211A probably benign Het
Ganc G T 2: 120,431,067 V343F probably benign Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gnmt A T 17: 46,726,299 C186* probably null Het
Gpr75 A T 11: 30,892,072 I326F probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-T23 G T 17: 36,031,798 D149E probably damaging Het
Hmcn2 G T 2: 31,435,792 R4277L probably benign Het
Irf9 C A 14: 55,605,766 H94N probably benign Het
Jhy T C 9: 40,961,153 N20S probably benign Het
Klf17 C A 4: 117,760,371 C263F probably damaging Het
Lama5 T C 2: 180,180,637 Y2881C probably damaging Het
Lig1 T G 7: 13,311,028 I882S probably damaging Het
Ltn1 A T 16: 87,418,487 M420K possibly damaging Het
Mael T C 1: 166,235,508 E125G probably damaging Het
Mib2 C T 4: 155,657,415 D275N possibly damaging Het
Mical3 C T 6: 120,957,703 R1805Q probably damaging Het
Mllt10 A G 2: 18,203,633 D158G probably damaging Het
Mocs1 A G 17: 49,454,585 D569G possibly damaging Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtmr2 T C 9: 13,795,964 S199P probably damaging Het
Ndufaf5 T C 2: 140,187,755 V164A probably benign Het
Nek9 T C 12: 85,314,204 E518G probably benign Het
Nfatc2 T C 2: 168,571,490 I72V probably benign Het
Nlrp9c C T 7: 26,375,368 A746T possibly damaging Het
Nupl2 A G 5: 24,182,417 R402G probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfr1045 A T 2: 86,197,933 M273K possibly damaging Het
Olfr1225 G A 2: 89,170,901 H104Y probably damaging Het
Olfr146 T A 9: 39,019,379 Y54F probably benign Het
Olfr411 A G 11: 74,346,963 V207A probably benign Het
Olfr881 A T 9: 37,993,085 I198F possibly damaging Het
Otof A G 5: 30,420,974 probably null Het
Pcdhb17 T C 18: 37,486,206 S350P probably damaging Het
Phf3 T C 1: 30,829,946 T674A probably damaging Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Ppfia3 T C 7: 45,352,093 E465G probably damaging Het
Prkg1 T A 19: 31,664,239 I15F probably damaging Het
Rab5c A G 11: 100,720,017 F22L probably damaging Het
Raf1 A G 6: 115,632,919 S220P probably damaging Het
Rhbg C A 3: 88,245,966 W205L probably damaging Het
Rimbp3 A G 16: 17,209,189 E159G possibly damaging Het
Ryr1 T C 7: 29,059,831 D3338G probably null Het
Sash1 T C 10: 8,730,385 N747S probably benign Het
Serpina3g A T 12: 104,239,220 I73F probably damaging Het
Sfxn2 C A 19: 46,585,774 N134K probably damaging Het
Slc12a6 A G 2: 112,354,295 H853R probably damaging Het
Slc16a12 C T 19: 34,672,565 D357N probably damaging Het
Slc39a8 T C 3: 135,856,011 Y164H probably benign Het
Snx9 A G 17: 5,927,224 K518E probably damaging Het
Spdye4c G A 2: 128,592,353 V5I possibly damaging Het
Spef2 A G 15: 9,676,373 V704A probably benign Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Strap C A 6: 137,735,386 S11* probably null Het
Synpo2 A G 3: 123,113,063 L868P probably damaging Het
Tenm2 A G 11: 36,010,487 V2474A probably damaging Het
Tm9sf4 T A 2: 153,187,308 V92D probably damaging Het
Tmf1 A T 6: 97,170,427 M526K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc39d A G 17: 80,217,639 I576V probably benign Het
Upk1a T G 7: 30,605,129 T193P probably benign Het
Vmn2r67 A T 7: 85,150,524 V502E probably benign Het
Wdr17 A G 8: 54,690,048 V189A possibly damaging Het
Wrap73 A T 4: 154,151,696 S161C probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Zfp605 T A 5: 110,127,361 M115K possibly damaging Het
Zp1 T A 19: 10,918,905 H152L probably benign Het
Other mutations in Rgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Rgl1 APN 1 152571617 missense probably benign 0.02
IGL01065:Rgl1 APN 1 152519142 missense probably damaging 1.00
IGL01390:Rgl1 APN 1 152571588 splice site probably benign
IGL01726:Rgl1 APN 1 152519153 missense probably damaging 1.00
IGL01837:Rgl1 APN 1 152549150 missense probably damaging 1.00
IGL02019:Rgl1 APN 1 152528469 splice site probably benign
IGL02369:Rgl1 APN 1 152533606 missense probably damaging 1.00
R0240:Rgl1 UTSW 1 152554424 unclassified probably benign
R0255:Rgl1 UTSW 1 152552596 missense probably damaging 1.00
R0562:Rgl1 UTSW 1 152539945 missense probably damaging 1.00
R0648:Rgl1 UTSW 1 152536265 critical splice donor site probably null
R0734:Rgl1 UTSW 1 152554300 missense probably damaging 0.98
R1187:Rgl1 UTSW 1 152544433 missense probably benign 0.14
R1522:Rgl1 UTSW 1 152586533 missense probably damaging 1.00
R1595:Rgl1 UTSW 1 152675023 splice site probably benign
R1634:Rgl1 UTSW 1 152524772 missense probably damaging 1.00
R1661:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1665:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1964:Rgl1 UTSW 1 152549104 missense probably damaging 1.00
R2291:Rgl1 UTSW 1 152536281 missense probably damaging 1.00
R4272:Rgl1 UTSW 1 152536289 missense probably benign 0.13
R4668:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4747:Rgl1 UTSW 1 152524699 nonsense probably null
R4830:Rgl1 UTSW 1 152554330 missense probably benign 0.11
R4853:Rgl1 UTSW 1 152557574 missense probably benign 0.07
R4969:Rgl1 UTSW 1 152549062 splice site probably null
R5778:Rgl1 UTSW 1 152552421 missense probably benign 0.05
R5979:Rgl1 UTSW 1 152557493 missense probably damaging 1.00
R6180:Rgl1 UTSW 1 152519172 missense probably damaging 1.00
R6183:Rgl1 UTSW 1 152586570 missense possibly damaging 0.94
R6322:Rgl1 UTSW 1 152552435 missense probably damaging 0.98
R6678:Rgl1 UTSW 1 152524724 missense probably damaging 1.00
R6759:Rgl1 UTSW 1 152533530 missense probably damaging 0.99
R6892:Rgl1 UTSW 1 152539940 missense probably benign 0.00
R7290:Rgl1 UTSW 1 152544395 missense possibly damaging 0.78
R7363:Rgl1 UTSW 1 152519163 missense probably damaging 1.00
Z1088:Rgl1 UTSW 1 152675020 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TATGTGCATATGCCCCTGCC -3'
(R):5'- TTCACCTGCTCATTCAGAAGTAGTAC -3'

Sequencing Primer
(F):5'- TGCCATCACTAGGATCCAAATG -3'
(R):5'- GTAGTACTAGCACTCAGGAGCC -3'
Posted On2015-10-08