Incidental Mutation 'R0270:Hirip3'
ID35222
Institutional Source Beutler Lab
Gene Symbol Hirip3
Ensembl Gene ENSMUSG00000042606
Gene NameHIRA interacting protein 3
Synonyms
MMRRC Submission 038496-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0270 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126861972-126865377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 126863191 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 46 (S46R)
Ref Sequence ENSEMBL: ENSMUSP00000115145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037248] [ENSMUST00000050833] [ENSMUST00000071268] [ENSMUST00000106342] [ENSMUST00000106343] [ENSMUST00000129812] [ENSMUST00000132808] [ENSMUST00000205349] [ENSMUST00000206349] [ENSMUST00000206968] [ENSMUST00000214525]
Predicted Effect probably damaging
Transcript: ENSMUST00000037248
AA Change: S106R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035535
Gene: ENSMUSG00000042606
AA Change: S106R

DomainStartEndE-ValueType
low complexity region 96 113 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 229 244 N/A INTRINSIC
low complexity region 286 339 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 405 419 N/A INTRINSIC
internal_repeat_1 420 443 6.44e-5 PROSPERO
internal_repeat_1 440 463 6.44e-5 PROSPERO
CHZ 529 565 1.17e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050833
SMART Domains Protein: ENSMUSP00000049851
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 86 108 N/A INTRINSIC
low complexity region 116 132 N/A INTRINSIC
low complexity region 163 171 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071268
SMART Domains Protein: ENSMUSP00000071246
Gene: ENSMUSG00000059981

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
coiled coil region 821 859 N/A INTRINSIC
low complexity region 863 892 N/A INTRINSIC
low complexity region 931 954 N/A INTRINSIC
low complexity region 963 972 N/A INTRINSIC
low complexity region 977 992 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106342
SMART Domains Protein: ENSMUSP00000101949
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 44 66 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106343
SMART Domains Protein: ENSMUSP00000101950
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
coiled coil region 10 55 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 125 147 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 202 210 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129746
Predicted Effect probably benign
Transcript: ENSMUST00000129812
SMART Domains Protein: ENSMUSP00000114606
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
SCOP:d1iw7c_ 15 37 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132552
Predicted Effect probably damaging
Transcript: ENSMUST00000132808
AA Change: S46R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115145
Gene: ENSMUSG00000042606
AA Change: S46R

DomainStartEndE-ValueType
low complexity region 36 53 N/A INTRINSIC
low complexity region 88 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154881
Predicted Effect probably benign
Transcript: ENSMUST00000205349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205512
Predicted Effect probably benign
Transcript: ENSMUST00000205619
Predicted Effect probably benign
Transcript: ENSMUST00000205958
Predicted Effect probably benign
Transcript: ENSMUST00000206349
Predicted Effect probably benign
Transcript: ENSMUST00000206968
Predicted Effect probably benign
Transcript: ENSMUST00000214525
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 96.0%
  • 20x: 93.2%
Validation Efficiency 99% (113/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The HIRA protein shares sequence similarity with Hir1p and Hir2p, the two corepressors of histone gene transcription characterized in the yeast, Saccharomyces cerevisiae. The structural features of the HIRA protein suggest that it may function as part of a multiprotein complex. Several cDNAs encoding HIRA-interacting proteins, or HIRIPs, have been identified. In vitro, the protein encoded by this gene binds HIRA, as well as H2B and H3 core histones, indicating that a complex containing HIRA-HIRIP3 could function in some aspects of chromatin and histone metabolism. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,166,176 probably benign Het
4922502D21Rik A T 6: 129,325,608 L152* probably null Het
Abcf3 T A 16: 20,560,168 probably null Het
Acadm C T 3: 153,936,324 M190I possibly damaging Het
Adamtsl3 G A 7: 82,556,824 R739Q probably damaging Het
Ank1 T A 8: 23,088,925 probably benign Het
Ap3b1 T A 13: 94,404,118 probably benign Het
Arhgdib A G 6: 136,926,734 V31A probably damaging Het
Arid4a A G 12: 71,072,632 R342G probably damaging Het
Asic3 C T 5: 24,417,702 L517F probably benign Het
Atxn7l1 C T 12: 33,342,151 P242L possibly damaging Het
AY761185 T A 8: 20,944,600 E37D possibly damaging Het
Babam1 T A 8: 71,398,406 D104E probably damaging Het
Batf A T 12: 85,708,672 T100S probably benign Het
Blcap A T 2: 157,557,977 Y59* probably null Het
Cacnb3 G A 15: 98,642,559 A350T probably damaging Het
Cdk15 T A 1: 59,310,806 V319D probably damaging Het
Cenpf T C 1: 189,650,714 H2661R probably benign Het
Cenpq T C 17: 40,930,050 E106G probably damaging Het
Cfap43 A G 19: 47,797,203 probably benign Het
Cfb G A 17: 34,860,386 S778L possibly damaging Het
Clspn T A 4: 126,573,236 N631K probably damaging Het
Cntn2 T A 1: 132,521,724 T660S probably damaging Het
Cntrob T A 11: 69,311,341 H475L possibly damaging Het
Ddx46 T C 13: 55,674,104 I863T probably benign Het
Dnah11 G A 12: 118,041,013 T2191I probably damaging Het
Dock9 T C 14: 121,575,999 T1703A probably benign Het
Fam13c C T 10: 70,544,513 P424S probably benign Het
Fan1 T C 7: 64,348,871 N968D probably benign Het
Fbxl20 A T 11: 98,098,503 probably benign Het
Fkbp1b A T 12: 4,838,229 probably benign Het
G930045G22Rik T A 6: 50,847,059 noncoding transcript Het
Gm28042 C A 2: 120,041,592 R1008S probably benign Het
Gm6614 T A 6: 141,972,411 I580F possibly damaging Het
Gm8298 T A 3: 59,877,019 N304K probably benign Het
Gon4l G A 3: 88,858,400 S376N probably damaging Het
Gstt3 C A 10: 75,780,915 R15L probably damaging Het
Gtdc1 A T 2: 44,752,174 S73T possibly damaging Het
H2afy G A 13: 56,096,114 probably benign Het
Hhatl A G 9: 121,784,720 S419P probably benign Het
Hsf2 A G 10: 57,502,639 T204A probably benign Het
Impg2 G A 16: 56,269,015 E1108K possibly damaging Het
Itgb2l G T 16: 96,422,930 probably benign Het
Itih5 A T 2: 10,251,264 N847I probably benign Het
Kif1a T C 1: 93,054,442 probably benign Het
Klhl1 T A 14: 96,518,344 probably benign Het
Ktn1 T A 14: 47,714,662 D963E probably benign Het
Lclat1 T A 17: 73,240,027 V313E probably benign Het
Lrrn4 T C 2: 132,870,719 S395G probably benign Het
Mbtps1 G A 8: 119,538,117 probably benign Het
Me1 A G 9: 86,596,204 probably benign Het
Mov10 C A 3: 104,795,405 C948F probably benign Het
Mterf1a G A 5: 3,890,990 Q293* probably null Het
Nfkb2 A T 19: 46,311,626 M838L possibly damaging Het
Nhlrc2 T A 19: 56,551,870 L97Q probably damaging Het
Nr6a1 A T 2: 38,739,020 Y331N possibly damaging Het
Nup214 C T 2: 32,034,814 A1785V probably damaging Het
Ogg1 C T 6: 113,329,256 T138I probably benign Het
Olfr1461 A G 19: 13,165,887 Y291C probably damaging Het
Olfr1489 A G 19: 13,633,684 Y191C probably damaging Het
Olfr202 A G 16: 59,283,753 V248A probably damaging Het
Olfr829 T A 9: 18,856,831 Y60N probably damaging Het
Plod2 G T 9: 92,584,521 R178L probably benign Het
Polr3b T A 10: 84,718,475 L1017Q probably benign Het
Postn C A 3: 54,384,550 T724N probably damaging Het
Ppm1l T G 3: 69,317,976 probably benign Het
Prpf8 T G 11: 75,505,249 L1983R probably damaging Het
Psma7 A G 2: 180,039,400 V59A probably benign Het
Qser1 T A 2: 104,788,961 Y502F probably benign Het
Rad50 T C 11: 53,668,025 D1129G probably damaging Het
Rasal1 C A 5: 120,674,729 P606Q probably damaging Het
Rgs6 A G 12: 83,133,689 Y438C probably damaging Het
Rnf180 A G 13: 105,252,266 C73R probably benign Het
Rnf216 T A 5: 143,080,241 I474F possibly damaging Het
Sdha A T 13: 74,332,247 L371Q probably damaging Het
Sdk1 T G 5: 142,084,566 L1162R possibly damaging Het
Sh3rf2 T C 18: 42,104,081 I223T probably damaging Het
Sirpb1a A G 3: 15,410,527 V316A probably damaging Het
Slc12a4 A T 8: 105,945,389 I897N probably benign Het
Slc35d1 A T 4: 103,190,838 V243E probably damaging Het
Slc4a11 T A 2: 130,690,932 K200N possibly damaging Het
Slc9a8 T A 2: 167,451,296 M188K probably damaging Het
Snrnp200 T C 2: 127,232,982 S1492P probably damaging Het
Sphk2 T C 7: 45,710,725 *618W probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tdpoz3 A G 3: 93,826,924 N302S probably benign Het
Tdrd6 T C 17: 43,624,308 M1950V probably benign Het
Tmem39a A G 16: 38,564,313 probably benign Het
Trip4 A T 9: 65,858,358 I353K probably damaging Het
Trip6 A T 5: 137,312,841 F204L probably benign Het
Trpm4 T A 7: 45,319,253 I419F possibly damaging Het
Ttn C A 2: 76,944,796 E1967D probably damaging Het
Uba2 C T 7: 34,150,856 V391M possibly damaging Het
Ubr4 T G 4: 139,479,435 probably benign Het
Upf1 G A 8: 70,335,645 probably benign Het
Vmn1r228 A C 17: 20,776,596 V220G possibly damaging Het
Vmn2r79 A G 7: 87,003,386 M429V probably benign Het
Vps36 C T 8: 22,210,456 T210I possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Ybx1 C T 4: 119,281,591 G126D probably benign Het
Yipf5 C A 18: 40,206,407 probably benign Het
Zdhhc5 A C 2: 84,690,115 S573A probably benign Het
Zfp457 A T 13: 67,293,927 C99S probably damaging Het
Zfp52 T A 17: 21,561,302 C471S probably damaging Het
Zfp558 C T 9: 18,467,956 V71I probably damaging Het
Zfp651 A G 9: 121,767,575 T666A probably benign Het
Zfp655 A G 5: 145,244,457 Y375C probably damaging Het
Zfp882 A T 8: 71,914,615 T429S probably benign Het
Zmym2 T C 14: 56,949,684 probably null Het
Other mutations in Hirip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Hirip3 APN 7 126862704 missense probably damaging 1.00
IGL01531:Hirip3 APN 7 126863376 missense possibly damaging 0.72
IGL01885:Hirip3 APN 7 126864209 missense probably benign 0.00
R0126:Hirip3 UTSW 7 126863442 missense probably damaging 0.99
R1185:Hirip3 UTSW 7 126863660 frame shift probably null
R1185:Hirip3 UTSW 7 126863660 frame shift probably null
R1185:Hirip3 UTSW 7 126863660 frame shift probably null
R1676:Hirip3 UTSW 7 126863475 unclassified probably null
R1792:Hirip3 UTSW 7 126862620 missense probably damaging 0.98
R1951:Hirip3 UTSW 7 126862866 missense probably damaging 0.96
R2327:Hirip3 UTSW 7 126862866 missense probably damaging 0.96
R4674:Hirip3 UTSW 7 126864662 critical splice donor site probably null
R5024:Hirip3 UTSW 7 126864489 splice site probably null
R5523:Hirip3 UTSW 7 126863862 missense possibly damaging 0.62
R6876:Hirip3 UTSW 7 126864149 missense probably damaging 1.00
R7181:Hirip3 UTSW 7 126864063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCCAAAGAAGAAAAGGTTCCGC -3'
(R):5'- TGATCTAACAGAGCCCTCTGCTTCC -3'

Sequencing Primer
(F):5'- TCCGCTTTAATTCAGAGTCAGG -3'
(R):5'- TGCTTCCCCCTCACTGC -3'
Posted On2013-05-09