Incidental Mutation 'R4669:Spef2'
ID352304
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
MMRRC Submission 041925-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4669 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9676373 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 704 (V704A)
Ref Sequence ENSEMBL: ENSMUSP00000146967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000160236] [ENSMUST00000208854]
Predicted Effect probably benign
Transcript: ENSMUST00000041840
AA Change: V704A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: V704A

DomainStartEndE-ValueType
Pfam:DUF1042 5 161 2.8e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 829 5.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160236
AA Change: V704A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: V704A

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208854
AA Change: V704A

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Acan A G 7: 79,101,142 E464G probably benign Het
Agap1 A G 1: 89,837,806 probably null Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Ap2a1 A T 7: 44,902,919 probably benign Het
Arap3 T C 18: 37,996,254 D217G probably benign Het
Arl2 C A 19: 6,134,686 R179L probably damaging Het
Atg2a T A 19: 6,258,987 probably null Het
B3gat1 T A 9: 26,751,756 L6Q probably benign Het
Bcl10 A G 3: 145,930,572 N75S probably damaging Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Brms1l A G 12: 55,841,571 E48G possibly damaging Het
C2cd2l A T 9: 44,315,025 N414K possibly damaging Het
Capn2 C T 1: 182,470,780 C640Y probably benign Het
Ccdc153 G T 9: 44,245,724 R99M probably damaging Het
Ccdc51 A G 9: 109,090,962 N142S probably benign Het
Ccdc58 A G 16: 36,082,719 D27G probably damaging Het
Cdipt A G 7: 126,978,406 H108R possibly damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Cts3 C T 13: 61,566,823 E223K probably benign Het
Cyp2a22 T C 7: 26,937,855 D168G possibly damaging Het
Cyp2c67 T A 19: 39,643,654 H90L probably benign Het
Ddx4 T C 13: 112,622,244 Y261C probably damaging Het
Dnah17 T C 11: 118,074,293 T2308A probably benign Het
Dnah6 T C 6: 73,037,688 T3587A probably damaging Het
Dpy19l1 C T 9: 24,432,368 V494I possibly damaging Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Emilin3 T C 2: 160,910,797 I78V probably benign Het
Esam T A 9: 37,536,656 Y195* probably null Het
Extl3 T A 14: 65,076,296 N479I possibly damaging Het
Fat2 A G 11: 55,311,615 V211A probably benign Het
Ganc G T 2: 120,431,067 V343F probably benign Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gnmt A T 17: 46,726,299 C186* probably null Het
Gpr75 A T 11: 30,892,072 I326F probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-T23 G T 17: 36,031,798 D149E probably damaging Het
Hmcn2 G T 2: 31,435,792 R4277L probably benign Het
Irf9 C A 14: 55,605,766 H94N probably benign Het
Jhy T C 9: 40,961,153 N20S probably benign Het
Klf17 C A 4: 117,760,371 C263F probably damaging Het
Lama5 T C 2: 180,180,637 Y2881C probably damaging Het
Lig1 T G 7: 13,311,028 I882S probably damaging Het
Ltn1 A T 16: 87,418,487 M420K possibly damaging Het
Mael T C 1: 166,235,508 E125G probably damaging Het
Mib2 C T 4: 155,657,415 D275N possibly damaging Het
Mical3 C T 6: 120,957,703 R1805Q probably damaging Het
Mllt10 A G 2: 18,203,633 D158G probably damaging Het
Mocs1 A G 17: 49,454,585 D569G possibly damaging Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtmr2 T C 9: 13,795,964 S199P probably damaging Het
Ndufaf5 T C 2: 140,187,755 V164A probably benign Het
Nek9 T C 12: 85,314,204 E518G probably benign Het
Nfatc2 T C 2: 168,571,490 I72V probably benign Het
Nlrp9c C T 7: 26,375,368 A746T possibly damaging Het
Nupl2 A G 5: 24,182,417 R402G probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfr1045 A T 2: 86,197,933 M273K possibly damaging Het
Olfr1225 G A 2: 89,170,901 H104Y probably damaging Het
Olfr146 T A 9: 39,019,379 Y54F probably benign Het
Olfr411 A G 11: 74,346,963 V207A probably benign Het
Olfr881 A T 9: 37,993,085 I198F possibly damaging Het
Otof A G 5: 30,420,974 probably null Het
Pcdhb17 T C 18: 37,486,206 S350P probably damaging Het
Phf3 T C 1: 30,829,946 T674A probably damaging Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Ppfia3 T C 7: 45,352,093 E465G probably damaging Het
Prkg1 T A 19: 31,664,239 I15F probably damaging Het
Rab5c A G 11: 100,720,017 F22L probably damaging Het
Raf1 A G 6: 115,632,919 S220P probably damaging Het
Rgl1 T G 1: 152,521,371 R716S probably damaging Het
Rhbg C A 3: 88,245,966 W205L probably damaging Het
Rimbp3 A G 16: 17,209,189 E159G possibly damaging Het
Ryr1 T C 7: 29,059,831 D3338G probably null Het
Sash1 T C 10: 8,730,385 N747S probably benign Het
Serpina3g A T 12: 104,239,220 I73F probably damaging Het
Sfxn2 C A 19: 46,585,774 N134K probably damaging Het
Slc12a6 A G 2: 112,354,295 H853R probably damaging Het
Slc16a12 C T 19: 34,672,565 D357N probably damaging Het
Slc39a8 T C 3: 135,856,011 Y164H probably benign Het
Snx9 A G 17: 5,927,224 K518E probably damaging Het
Spdye4c G A 2: 128,592,353 V5I possibly damaging Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Strap C A 6: 137,735,386 S11* probably null Het
Synpo2 A G 3: 123,113,063 L868P probably damaging Het
Tenm2 A G 11: 36,010,487 V2474A probably damaging Het
Tm9sf4 T A 2: 153,187,308 V92D probably damaging Het
Tmf1 A T 6: 97,170,427 M526K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttc39d A G 17: 80,217,639 I576V probably benign Het
Upk1a T G 7: 30,605,129 T193P probably benign Het
Vmn2r67 A T 7: 85,150,524 V502E probably benign Het
Wdr17 A G 8: 54,690,048 V189A possibly damaging Het
Wrap73 A T 4: 154,151,696 S161C probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Zfp605 T A 5: 110,127,361 M115K possibly damaging Het
Zp1 T A 19: 10,918,905 H152L probably benign Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACAGCCAGCTTCATGTTCTC -3'
(R):5'- GATACCTGTGGACCAAAGCTG -3'

Sequencing Primer
(F):5'- ACCATGGAGTTAAAAAGAAAACCC -3'
(R):5'- CCAAAGCTGGGTTCTTGATGGATTTC -3'
Posted On2015-10-08