Incidental Mutation 'R4655:Mmp9'
ID352332
Institutional Source Beutler Lab
Gene Symbol Mmp9
Ensembl Gene ENSMUSG00000017737
Gene Namematrix metallopeptidase 9
Synonymsgelatinase B, MMP-9, Gelatinase B, B/MMP9, Gel B, Clg4b
MMRRC Submission 041915-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4655 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164940780-164955850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164951202 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 424 (S424G)
Ref Sequence ENSEMBL: ENSMUSP00000017881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017881] [ENSMUST00000137626]
Predicted Effect probably benign
Transcript: ENSMUST00000017881
AA Change: S424G

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000017881
Gene: ENSMUSG00000017737
AA Change: S424G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 39 95 2.9e-8 PFAM
ZnMc 112 445 3.92e-39 SMART
FN2 223 271 8.08e-29 SMART
FN2 281 329 6.93e-28 SMART
FN2 340 388 9.28e-29 SMART
low complexity region 449 468 N/A INTRINSIC
Pfam:PT 474 508 1.1e-11 PFAM
HX 539 583 2.4e-8 SMART
HX 585 626 9.33e-6 SMART
HX 631 677 2.74e-3 SMART
HX 679 721 1.74e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134382
Predicted Effect probably benign
Transcript: ENSMUST00000137626
SMART Domains Protein: ENSMUSP00000120628
Gene: ENSMUSG00000017737

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:1L6J|A 20 67 5e-15 PDB
SCOP:d1l6ja1 29 67 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144917
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens of type IV, V and XI, and elastin. Mice lacking the encoded protein exhibit an abnormal pattern of skeletal growth plate vascularization and ossification, reduced keratinocyte hyperproliferation at all neoplastic stages, a decreased incidence of invasive tumors, and resistance to experimental autoimmune encephalomyelitis. [provided by RefSeq, Feb 2016]
PHENOTYPE: Null mutants have short long bones with compensatory growth via delayed ossification and apoptosis of hypertrophic chondroctyes. Mutants are protected against ischemic brain injury, damage caused by myocardial infarction, and allergic airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,858 V300A probably benign Het
Abca4 A G 3: 122,147,498 N405S possibly damaging Het
Acsl3 A G 1: 78,690,346 T212A probably damaging Het
Ahnak A G 19: 9,008,701 K2450E probably damaging Het
Akap9 G A 5: 4,046,403 R2426H probably benign Het
Akr1c6 T C 13: 4,449,429 V266A probably damaging Het
Ccs A G 19: 4,839,204 V11A probably benign Het
Cdc14a T A 3: 116,328,487 H228L probably damaging Het
Cgn G A 3: 94,779,249 Q248* probably null Het
Cux2 G A 5: 121,885,934 T92M possibly damaging Het
Cyb5r4 A G 9: 87,059,429 K68E probably benign Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dnah9 T C 11: 65,955,732 N2918S probably benign Het
Dyrk1b T C 7: 28,185,751 V438A probably damaging Het
Eml1 G A 12: 108,534,713 D625N probably damaging Het
Eno2 T C 6: 124,763,926 probably null Het
Ephb3 G A 16: 21,222,208 G672D probably damaging Het
Evx1 A T 6: 52,314,197 D118V probably damaging Het
Fbxl13 A G 5: 21,582,039 L300S probably damaging Het
Fbxo30 T C 10: 11,291,093 F520L probably damaging Het
Flt3 G A 5: 147,349,593 P728S possibly damaging Het
Gas2l2 T C 11: 83,423,175 E437G possibly damaging Het
Gldc A T 19: 30,160,702 probably benign Het
Gm10334 T A 6: 41,446,050 I6F probably benign Het
Gm13124 A T 4: 144,555,075 F382L probably benign Het
Gm18856 T C 13: 13,965,647 probably benign Het
Gm7358 A T 17: 14,059,148 noncoding transcript Het
Grifin A G 5: 140,564,545 V47A possibly damaging Het
Hddc2 G T 10: 31,328,020 probably benign Het
Hist1h3f T C 13: 23,544,753 V90A probably benign Het
Hkdc1 T A 10: 62,400,463 R433S probably benign Het
Htt A G 5: 34,906,132 D2918G probably benign Het
Itga2 A C 13: 114,873,269 D383E probably benign Het
Itpr1 G A 6: 108,481,293 C2007Y probably damaging Het
Krt42 C A 11: 100,269,845 Q9H probably damaging Het
Lyrm7 T C 11: 54,848,608 Q72R probably damaging Het
Mtr A G 13: 12,227,793 V457A probably damaging Het
Myo15b T C 11: 115,890,697 L1359P probably damaging Het
Neb A G 2: 52,227,299 L4087P probably damaging Het
Npl T C 1: 153,515,406 D201G probably damaging Het
Olfr1047 A G 2: 86,228,693 S93P probably benign Het
Olfr366 A G 2: 37,219,873 N128S probably benign Het
Olfr905 C A 9: 38,472,824 P26T probably damaging Het
Pclo T C 5: 14,682,383 probably benign Het
Pdp2 A G 8: 104,594,536 D339G probably benign Het
Pfdn6 A T 17: 33,940,040 Y16* probably null Het
Pilra C T 5: 137,835,326 probably null Het
Prrc2a A T 17: 35,155,614 N1353K probably benign Het
Ptger4 C A 15: 5,243,064 A50S probably benign Het
Pus10 T C 11: 23,672,707 V109A probably benign Het
Pus3 A C 9: 35,564,932 D39A probably benign Het
Rab44 A G 17: 29,139,194 N119D probably benign Het
Rasgrp2 T C 19: 6,404,846 probably benign Het
Rhobtb2 T A 14: 69,795,989 I511F probably damaging Het
Sfxn1 C A 13: 54,092,438 A167D probably benign Het
Slc12a6 A G 2: 112,357,766 probably null Het
Smyd4 C T 11: 75,390,732 L344F probably damaging Het
Srsf11 A G 3: 158,023,335 V93A probably benign Het
Tle1 A G 4: 72,145,344 I224T possibly damaging Het
Tmc6 A T 11: 117,773,042 S479R possibly damaging Het
Tmprss4 T C 9: 45,176,404 M296V probably benign Het
Togaram1 A G 12: 64,967,120 N382D possibly damaging Het
Tpcn1 A G 5: 120,539,257 S662P probably damaging Het
Tppp G T 13: 74,030,864 R141S probably benign Het
Ttc21a A G 9: 119,961,762 D858G possibly damaging Het
Tuba3a A G 6: 125,281,167 S287P possibly damaging Het
Unc80 T G 1: 66,671,662 S2697A probably benign Het
Vmn1r69 A G 7: 10,580,099 V235A probably benign Het
Vmn2r26 T A 6: 124,061,416 I650N probably damaging Het
Vmn2r53 G A 7: 12,582,005 T629I possibly damaging Het
Vmn2r74 T C 7: 85,961,347 T46A probably benign Het
Vmn2r84 A T 10: 130,394,104 C46* probably null Het
Vps13b T C 15: 35,770,689 S2093P probably benign Het
Wdfy4 T C 14: 32,989,936 R2375G probably damaging Het
Wnk2 T G 13: 49,056,883 E1820A probably damaging Het
Other mutations in Mmp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Mmp9 APN 2 164949989 missense probably benign 0.13
IGL01980:Mmp9 APN 2 164950916 missense probably benign 0.01
IGL02117:Mmp9 APN 2 164949724 missense probably damaging 1.00
IGL02515:Mmp9 APN 2 164948956 missense probably damaging 1.00
IGL02756:Mmp9 APN 2 164949315 missense probably benign 0.27
IGL02833:Mmp9 APN 2 164949803 missense probably damaging 1.00
IGL02893:Mmp9 APN 2 164949068 splice site probably null
IGL02949:Mmp9 APN 2 164951119 missense probably damaging 1.00
IGL03097:Mmp9 UTSW 2 164950806 intron probably null
R0001:Mmp9 UTSW 2 164948383 missense probably benign 0.02
R0125:Mmp9 UTSW 2 164951257 missense probably damaging 1.00
R0532:Mmp9 UTSW 2 164949820 nonsense probably null
R1300:Mmp9 UTSW 2 164948956 missense probably damaging 1.00
R1341:Mmp9 UTSW 2 164949327 missense probably damaging 1.00
R1366:Mmp9 UTSW 2 164953342 missense probably damaging 1.00
R1711:Mmp9 UTSW 2 164949422 missense probably damaging 1.00
R2138:Mmp9 UTSW 2 164952467 nonsense probably null
R3405:Mmp9 UTSW 2 164949390 missense probably damaging 0.99
R3406:Mmp9 UTSW 2 164949390 missense probably damaging 0.99
R4460:Mmp9 UTSW 2 164949038 missense probably damaging 0.99
R5155:Mmp9 UTSW 2 164949066 critical splice donor site probably null
R5309:Mmp9 UTSW 2 164950795 unclassified probably benign
R5355:Mmp9 UTSW 2 164950992 missense possibly damaging 0.76
R5476:Mmp9 UTSW 2 164952494 missense probably benign
R5505:Mmp9 UTSW 2 164953608 missense probably benign 0.34
R5646:Mmp9 UTSW 2 164949050 missense probably benign 0.00
R5725:Mmp9 UTSW 2 164949336 missense possibly damaging 0.93
R6968:Mmp9 UTSW 2 164952940 missense probably benign
R7082:Mmp9 UTSW 2 164948892 missense probably benign 0.25
X0020:Mmp9 UTSW 2 164950373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCTGTCCAGACCAAGGTG -3'
(R):5'- TCCACTTACTGGGCACTCAG -3'

Sequencing Primer
(F):5'- TCCAGACCAAGGTGAGCGG -3'
(R):5'- GGCCCTGACCCAGATAGATATTG -3'
Posted On2015-10-08