Incidental Mutation 'R4655:Cdc14a'
ID352335
Institutional Source Beutler Lab
Gene Symbol Cdc14a
Ensembl Gene ENSMUSG00000033502
Gene NameCDC14 cell division cycle 14A
SynonymsCDC14A2, Cdc14, CDC14a1, A830059A17Rik
MMRRC Submission 041915-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R4655 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116272553-116424032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116328487 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 228 (H228L)
Ref Sequence ENSEMBL: ENSMUSP00000102100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090464] [ENSMUST00000106491] [ENSMUST00000197830]
Predicted Effect probably damaging
Transcript: ENSMUST00000090464
AA Change: H277L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087950
Gene: ENSMUSG00000033502
AA Change: H277L

DomainStartEndE-ValueType
Pfam:DSPn 13 153 1.6e-66 PFAM
Pfam:Y_phosphatase 210 324 1.1e-7 PFAM
Pfam:DSPc 214 328 1.8e-14 PFAM
low complexity region 539 558 N/A INTRINSIC
low complexity region 573 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106491
AA Change: H228L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102100
Gene: ENSMUSG00000033502
AA Change: H228L

DomainStartEndE-ValueType
Pfam:DSPn 12 121 9.5e-44 PFAM
Pfam:Y_phosphatase 160 274 6.4e-8 PFAM
Pfam:DSPc 160 280 2.8e-14 PFAM
low complexity region 490 509 N/A INTRINSIC
low complexity region 524 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127704
Predicted Effect probably benign
Transcript: ENSMUST00000197830
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. It is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, suggesting a role in cell cycle control. This protein has been shown to interact with, and dephosphorylate tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splicing of this gene results in several transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,858 V300A probably benign Het
Abca4 A G 3: 122,147,498 N405S possibly damaging Het
Acsl3 A G 1: 78,690,346 T212A probably damaging Het
Ahnak A G 19: 9,008,701 K2450E probably damaging Het
Akap9 G A 5: 4,046,403 R2426H probably benign Het
Akr1c6 T C 13: 4,449,429 V266A probably damaging Het
Ccs A G 19: 4,839,204 V11A probably benign Het
Cgn G A 3: 94,779,249 Q248* probably null Het
Cux2 G A 5: 121,885,934 T92M possibly damaging Het
Cyb5r4 A G 9: 87,059,429 K68E probably benign Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dnah9 T C 11: 65,955,732 N2918S probably benign Het
Dyrk1b T C 7: 28,185,751 V438A probably damaging Het
Eml1 G A 12: 108,534,713 D625N probably damaging Het
Eno2 T C 6: 124,763,926 probably null Het
Ephb3 G A 16: 21,222,208 G672D probably damaging Het
Evx1 A T 6: 52,314,197 D118V probably damaging Het
Fbxl13 A G 5: 21,582,039 L300S probably damaging Het
Fbxo30 T C 10: 11,291,093 F520L probably damaging Het
Flt3 G A 5: 147,349,593 P728S possibly damaging Het
Gas2l2 T C 11: 83,423,175 E437G possibly damaging Het
Gldc A T 19: 30,160,702 probably benign Het
Gm10334 T A 6: 41,446,050 I6F probably benign Het
Gm13124 A T 4: 144,555,075 F382L probably benign Het
Gm18856 T C 13: 13,965,647 probably benign Het
Gm7358 A T 17: 14,059,148 noncoding transcript Het
Grifin A G 5: 140,564,545 V47A possibly damaging Het
Hddc2 G T 10: 31,328,020 probably benign Het
Hist1h3f T C 13: 23,544,753 V90A probably benign Het
Hkdc1 T A 10: 62,400,463 R433S probably benign Het
Htt A G 5: 34,906,132 D2918G probably benign Het
Itga2 A C 13: 114,873,269 D383E probably benign Het
Itpr1 G A 6: 108,481,293 C2007Y probably damaging Het
Krt42 C A 11: 100,269,845 Q9H probably damaging Het
Lyrm7 T C 11: 54,848,608 Q72R probably damaging Het
Mmp9 A G 2: 164,951,202 S424G probably benign Het
Mtr A G 13: 12,227,793 V457A probably damaging Het
Myo15b T C 11: 115,890,697 L1359P probably damaging Het
Neb A G 2: 52,227,299 L4087P probably damaging Het
Npl T C 1: 153,515,406 D201G probably damaging Het
Olfr1047 A G 2: 86,228,693 S93P probably benign Het
Olfr366 A G 2: 37,219,873 N128S probably benign Het
Olfr905 C A 9: 38,472,824 P26T probably damaging Het
Pclo T C 5: 14,682,383 probably benign Het
Pdp2 A G 8: 104,594,536 D339G probably benign Het
Pfdn6 A T 17: 33,940,040 Y16* probably null Het
Pilra C T 5: 137,835,326 probably null Het
Prrc2a A T 17: 35,155,614 N1353K probably benign Het
Ptger4 C A 15: 5,243,064 A50S probably benign Het
Pus10 T C 11: 23,672,707 V109A probably benign Het
Pus3 A C 9: 35,564,932 D39A probably benign Het
Rab44 A G 17: 29,139,194 N119D probably benign Het
Rasgrp2 T C 19: 6,404,846 probably benign Het
Rhobtb2 T A 14: 69,795,989 I511F probably damaging Het
Sfxn1 C A 13: 54,092,438 A167D probably benign Het
Slc12a6 A G 2: 112,357,766 probably null Het
Smyd4 C T 11: 75,390,732 L344F probably damaging Het
Srsf11 A G 3: 158,023,335 V93A probably benign Het
Tle1 A G 4: 72,145,344 I224T possibly damaging Het
Tmc6 A T 11: 117,773,042 S479R possibly damaging Het
Tmprss4 T C 9: 45,176,404 M296V probably benign Het
Togaram1 A G 12: 64,967,120 N382D possibly damaging Het
Tpcn1 A G 5: 120,539,257 S662P probably damaging Het
Tppp G T 13: 74,030,864 R141S probably benign Het
Ttc21a A G 9: 119,961,762 D858G possibly damaging Het
Tuba3a A G 6: 125,281,167 S287P possibly damaging Het
Unc80 T G 1: 66,671,662 S2697A probably benign Het
Vmn1r69 A G 7: 10,580,099 V235A probably benign Het
Vmn2r26 T A 6: 124,061,416 I650N probably damaging Het
Vmn2r53 G A 7: 12,582,005 T629I possibly damaging Het
Vmn2r74 T C 7: 85,961,347 T46A probably benign Het
Vmn2r84 A T 10: 130,394,104 C46* probably null Het
Vps13b T C 15: 35,770,689 S2093P probably benign Het
Wdfy4 T C 14: 32,989,936 R2375G probably damaging Het
Wnk2 T G 13: 49,056,883 E1820A probably damaging Het
Other mutations in Cdc14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cdc14a APN 3 116294844 nonsense probably null
IGL01062:Cdc14a APN 3 116274712 splice site probably benign
IGL01584:Cdc14a APN 3 116392825 nonsense probably null
IGL03084:Cdc14a APN 3 116348452 critical splice donor site probably null
IGL03237:Cdc14a APN 3 116404626 intron probably benign
IGL03296:Cdc14a APN 3 116297158 missense probably benign 0.02
PIT4131001:Cdc14a UTSW 3 116328661 missense possibly damaging 0.66
R0707:Cdc14a UTSW 3 116293713 splice site probably benign
R0782:Cdc14a UTSW 3 116322136 missense probably damaging 1.00
R0835:Cdc14a UTSW 3 116328522 missense probably benign 0.12
R1363:Cdc14a UTSW 3 116293860 small deletion probably benign
R1507:Cdc14a UTSW 3 116293997 missense possibly damaging 0.47
R1545:Cdc14a UTSW 3 116293724 critical splice donor site probably null
R1795:Cdc14a UTSW 3 116298473 missense possibly damaging 0.81
R1797:Cdc14a UTSW 3 116322194 missense probably damaging 1.00
R1830:Cdc14a UTSW 3 116422647 nonsense probably null
R4229:Cdc14a UTSW 3 116293764 missense probably damaging 0.99
R4769:Cdc14a UTSW 3 116294750 critical splice donor site probably null
R4870:Cdc14a UTSW 3 116423460 missense probably benign 0.30
R4980:Cdc14a UTSW 3 116392857 nonsense probably null
R6228:Cdc14a UTSW 3 116351213 missense probably damaging 1.00
R6248:Cdc14a UTSW 3 116308194 missense probably benign 0.01
R6402:Cdc14a UTSW 3 116348459 missense probably damaging 1.00
R6749:Cdc14a UTSW 3 116297158 missense possibly damaging 0.68
R6852:Cdc14a UTSW 3 116328676 missense possibly damaging 0.94
R6996:Cdc14a UTSW 3 116328706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCAAGGCGATTAATCCTTTC -3'
(R):5'- TGTAGGTTACCCTCTCCACG -3'

Sequencing Primer
(F):5'- CAAGGCGATTAATCCTTTCTTTAGGG -3'
(R):5'- AGCCTACTTTCCATACTTCAAAAAG -3'
Posted On2015-10-08