Incidental Mutation 'R4655:Dyrk1b'
ID352356
Institutional Source Beutler Lab
Gene Symbol Dyrk1b
Ensembl Gene ENSMUSG00000002409
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b
SynonymsMirk
MMRRC Submission 041915-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R4655 (G1)
Quality Score149
Status Not validated
Chromosome7
Chromosomal Location28179469-28187294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28185751 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 438 (V438A)
Ref Sequence ENSEMBL: ENSMUSP00000133431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085901] [ENSMUST00000172467] [ENSMUST00000172761]
Predicted Effect probably benign
Transcript: ENSMUST00000085901
AA Change: V378A

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083064
Gene: ENSMUSG00000002409
AA Change: V378A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172467
AA Change: V438A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133431
Gene: ENSMUSG00000002409
AA Change: V438A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172761
SMART Domains Protein: ENSMUSP00000133719
Gene: ENSMUSG00000002409

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 391 1.52e-78 SMART
low complexity region 398 414 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
low complexity region 502 521 N/A INTRINSIC
low complexity region 531 551 N/A INTRINSIC
low complexity region 557 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173223
AA Change: V378A

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133364
Gene: ENSMUSG00000002409
AA Change: V378A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,858 V300A probably benign Het
Abca4 A G 3: 122,147,498 N405S possibly damaging Het
Acsl3 A G 1: 78,690,346 T212A probably damaging Het
Ahnak A G 19: 9,008,701 K2450E probably damaging Het
Akap9 G A 5: 4,046,403 R2426H probably benign Het
Akr1c6 T C 13: 4,449,429 V266A probably damaging Het
Ccs A G 19: 4,839,204 V11A probably benign Het
Cdc14a T A 3: 116,328,487 H228L probably damaging Het
Cgn G A 3: 94,779,249 Q248* probably null Het
Cux2 G A 5: 121,885,934 T92M possibly damaging Het
Cyb5r4 A G 9: 87,059,429 K68E probably benign Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dnah9 T C 11: 65,955,732 N2918S probably benign Het
Eml1 G A 12: 108,534,713 D625N probably damaging Het
Eno2 T C 6: 124,763,926 probably null Het
Ephb3 G A 16: 21,222,208 G672D probably damaging Het
Evx1 A T 6: 52,314,197 D118V probably damaging Het
Fbxl13 A G 5: 21,582,039 L300S probably damaging Het
Fbxo30 T C 10: 11,291,093 F520L probably damaging Het
Flt3 G A 5: 147,349,593 P728S possibly damaging Het
Gas2l2 T C 11: 83,423,175 E437G possibly damaging Het
Gldc A T 19: 30,160,702 probably benign Het
Gm10334 T A 6: 41,446,050 I6F probably benign Het
Gm13124 A T 4: 144,555,075 F382L probably benign Het
Gm18856 T C 13: 13,965,647 probably benign Het
Gm7358 A T 17: 14,059,148 noncoding transcript Het
Grifin A G 5: 140,564,545 V47A possibly damaging Het
Hddc2 G T 10: 31,328,020 probably benign Het
Hist1h3f T C 13: 23,544,753 V90A probably benign Het
Hkdc1 T A 10: 62,400,463 R433S probably benign Het
Htt A G 5: 34,906,132 D2918G probably benign Het
Itga2 A C 13: 114,873,269 D383E probably benign Het
Itpr1 G A 6: 108,481,293 C2007Y probably damaging Het
Krt42 C A 11: 100,269,845 Q9H probably damaging Het
Lyrm7 T C 11: 54,848,608 Q72R probably damaging Het
Mmp9 A G 2: 164,951,202 S424G probably benign Het
Mtr A G 13: 12,227,793 V457A probably damaging Het
Myo15b T C 11: 115,890,697 L1359P probably damaging Het
Neb A G 2: 52,227,299 L4087P probably damaging Het
Npl T C 1: 153,515,406 D201G probably damaging Het
Olfr1047 A G 2: 86,228,693 S93P probably benign Het
Olfr366 A G 2: 37,219,873 N128S probably benign Het
Olfr905 C A 9: 38,472,824 P26T probably damaging Het
Pclo T C 5: 14,682,383 probably benign Het
Pdp2 A G 8: 104,594,536 D339G probably benign Het
Pfdn6 A T 17: 33,940,040 Y16* probably null Het
Pilra C T 5: 137,835,326 probably null Het
Prrc2a A T 17: 35,155,614 N1353K probably benign Het
Ptger4 C A 15: 5,243,064 A50S probably benign Het
Pus10 T C 11: 23,672,707 V109A probably benign Het
Pus3 A C 9: 35,564,932 D39A probably benign Het
Rab44 A G 17: 29,139,194 N119D probably benign Het
Rasgrp2 T C 19: 6,404,846 probably benign Het
Rhobtb2 T A 14: 69,795,989 I511F probably damaging Het
Sfxn1 C A 13: 54,092,438 A167D probably benign Het
Slc12a6 A G 2: 112,357,766 probably null Het
Smyd4 C T 11: 75,390,732 L344F probably damaging Het
Srsf11 A G 3: 158,023,335 V93A probably benign Het
Tle1 A G 4: 72,145,344 I224T possibly damaging Het
Tmc6 A T 11: 117,773,042 S479R possibly damaging Het
Tmprss4 T C 9: 45,176,404 M296V probably benign Het
Togaram1 A G 12: 64,967,120 N382D possibly damaging Het
Tpcn1 A G 5: 120,539,257 S662P probably damaging Het
Tppp G T 13: 74,030,864 R141S probably benign Het
Ttc21a A G 9: 119,961,762 D858G possibly damaging Het
Tuba3a A G 6: 125,281,167 S287P possibly damaging Het
Unc80 T G 1: 66,671,662 S2697A probably benign Het
Vmn1r69 A G 7: 10,580,099 V235A probably benign Het
Vmn2r26 T A 6: 124,061,416 I650N probably damaging Het
Vmn2r53 G A 7: 12,582,005 T629I possibly damaging Het
Vmn2r74 T C 7: 85,961,347 T46A probably benign Het
Vmn2r84 A T 10: 130,394,104 C46* probably null Het
Vps13b T C 15: 35,770,689 S2093P probably benign Het
Wdfy4 T C 14: 32,989,936 R2375G probably damaging Het
Wnk2 T G 13: 49,056,883 E1820A probably damaging Het
Other mutations in Dyrk1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Dyrk1b APN 7 28182676 missense probably damaging 0.96
IGL01820:Dyrk1b APN 7 28181600 utr 5 prime probably benign
IGL03155:Dyrk1b APN 7 28182687 missense probably benign 0.25
R0280:Dyrk1b UTSW 7 28184312 missense probably damaging 1.00
R0323:Dyrk1b UTSW 7 28185356 missense probably benign 0.00
R0610:Dyrk1b UTSW 7 28186634 missense probably damaging 0.99
R0765:Dyrk1b UTSW 7 28185711 intron probably benign
R1858:Dyrk1b UTSW 7 28182646 unclassified probably null
R2354:Dyrk1b UTSW 7 28185372 missense possibly damaging 0.79
R4599:Dyrk1b UTSW 7 28182431 missense probably damaging 1.00
R5201:Dyrk1b UTSW 7 28185096 missense probably damaging 1.00
R5357:Dyrk1b UTSW 7 28185318 missense possibly damaging 0.79
R5560:Dyrk1b UTSW 7 28184253 missense possibly damaging 0.53
R6171:Dyrk1b UTSW 7 28186550 critical splice acceptor site probably null
R6751:Dyrk1b UTSW 7 28186709 missense probably damaging 1.00
R6901:Dyrk1b UTSW 7 28185117 missense probably damaging 1.00
R6918:Dyrk1b UTSW 7 28185925 missense probably damaging 0.99
X0060:Dyrk1b UTSW 7 28183150 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTACTTTGAGCGGCTGCC -3'
(R):5'- TCTATGACAGAGGCCCAGTG -3'

Sequencing Primer
(F):5'- ACTCACACTTGGGGCTCC -3'
(R):5'- CACATGTGACATGGGGCAC -3'
Posted On2015-10-08