Incidental Mutation 'R4657:Olfr347'
ID352487
Institutional Source Beutler Lab
Gene Symbol Olfr347
Ensembl Gene ENSMUSG00000111863
Gene Nameolfactory receptor 347
SynonymsGA_x6K02T2NLDC-33428755-33429693, MOR136-9
MMRRC Submission 041917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R4657 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36731902-36737640 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 36734403 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 27 (Y27*)
Ref Sequence ENSEMBL: ENSMUSP00000151158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078761] [ENSMUST00000216882]
Predicted Effect probably null
Transcript: ENSMUST00000078761
AA Change: Y27*
SMART Domains Protein: ENSMUSP00000077819
Gene: ENSMUSG00000111863
AA Change: Y27*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-5 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216882
AA Change: Y27*
Meta Mutation Damage Score 0.6504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,013,478 V264E possibly damaging Het
Abcg1 T A 17: 31,108,434 W368R probably benign Het
Acin1 A G 14: 54,643,047 I476T possibly damaging Het
Acsm1 T A 7: 119,640,694 I287N possibly damaging Het
Adgrv1 C T 13: 81,405,364 V5464I probably benign Het
AI429214 T A 8: 36,994,391 L231Q probably damaging Het
Akp3 A G 1: 87,125,834 probably benign Het
Amy2b C T 3: 113,153,477 noncoding transcript Het
Apoa5 A G 9: 46,269,872 Q82R probably benign Het
Arhgap44 A G 11: 65,005,452 probably null Het
Arhgef38 C A 3: 133,234,681 G48V probably damaging Het
Bod1l G T 5: 41,818,612 N1786K probably benign Het
Cav2 A T 6: 17,281,410 D17V probably null Het
Ccdc148 G T 2: 59,001,888 N238K probably benign Het
Ccin A T 4: 43,984,981 I463F probably damaging Het
Cd8b1 C T 6: 71,329,774 H162Y possibly damaging Het
Cdh16 T A 8: 104,615,226 probably null Het
Cfap65 T A 1: 74,925,354 probably benign Het
Clec4n T C 6: 123,232,196 probably null Het
Cpne7 T A 8: 123,134,575 *558R probably null Het
Cs A G 10: 128,353,137 I172V probably benign Het
Cyp2ab1 A T 16: 20,313,072 L306Q probably damaging Het
D16Ertd472e A T 16: 78,547,926 V98E probably damaging Het
Dcaf15 A C 8: 84,102,838 S92A probably damaging Het
Dkk3 T C 7: 112,149,046 probably null Het
Dnah11 A T 12: 118,192,427 C163S probably benign Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Eml4 A T 17: 83,450,948 K397* probably null Het
Eml6 A T 11: 29,805,108 I889N possibly damaging Het
Etaa1 A T 11: 17,946,964 D384E possibly damaging Het
Fzr1 T A 10: 81,367,552 probably null Het
Gm13889 G T 2: 93,956,576 F61L probably damaging Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gm5828 T A 1: 16,769,418 noncoding transcript Het
Gm5866 G A 5: 52,582,920 noncoding transcript Het
Gp2 T C 7: 119,457,168 I27M probably benign Het
Gpr83 G A 9: 14,866,983 probably null Het
Gucd1 T C 10: 75,511,125 N97S probably benign Het
H2-Q7 T A 17: 35,442,759 V326E possibly damaging Het
Haao A T 17: 83,832,345 D227E possibly damaging Het
Hipk3 C T 2: 104,433,759 S819N probably benign Het
Hist3h2ba C T 11: 58,948,971 P11L probably benign Het
Hlcs A G 16: 94,262,698 V501A probably benign Het
Hmcn1 A G 1: 150,624,550 Y3964H probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifi211 A G 1: 173,907,660 F68L probably benign Het
Ift57 A G 16: 49,762,594 probably null Het
Ighv5-12-4 A T 12: 113,762,267 L112* probably null Het
Il1f6 T A 2: 24,224,404 M97K possibly damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Itsn2 A G 12: 4,713,197 *1686W probably null Het
Jkamp G T 12: 72,094,049 V123F probably damaging Het
Kat7 C A 11: 95,277,598 V411L probably damaging Het
Kcnj5 A G 9: 32,322,677 V114A probably benign Het
Krtap5-4 T A 7: 142,303,754 C54S unknown Het
Lats1 T A 10: 7,705,684 N744K possibly damaging Het
Lpo T C 11: 87,814,347 E387G probably damaging Het
Lrba T G 3: 86,737,164 M388R probably damaging Het
Lrp2 C A 2: 69,466,993 R3208L probably damaging Het
Mterf1b T A 5: 4,197,176 C272* probably null Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh15 A T 16: 49,172,058 R1632* probably null Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo9a T C 9: 59,875,416 probably null Het
Nelfa T G 5: 33,901,813 S233R probably benign Het
Nr4a3 A T 4: 48,051,522 E121V probably damaging Het
Obscn T A 11: 59,042,290 E5406D probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr873 A C 9: 20,300,623 H142P probably damaging Het
Oxct2b T C 4: 123,117,133 L282P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb14 A G 18: 37,448,847 I335M possibly damaging Het
Pcsk1 T A 13: 75,132,235 D726E probably damaging Het
Pkhd1 T A 1: 20,364,167 Q2349L possibly damaging Het
Pkhd1l1 G A 15: 44,547,347 C2750Y probably damaging Het
Ppp2r3d A G 9: 124,476,821 C26R unknown Het
Prex2 T A 1: 11,065,825 I74N probably benign Het
Ptgir A G 7: 16,907,146 D121G probably benign Het
Ralbp1 T C 17: 65,852,691 S526G probably null Het
Ric8b T C 10: 84,992,137 Y442H probably damaging Het
Rpap1 C T 2: 119,775,006 D385N probably benign Het
Sash1 T C 10: 8,725,660 Y1177C probably damaging Het
Shroom1 T C 11: 53,465,588 I363T possibly damaging Het
Slc26a9 T C 1: 131,753,138 L95P probably damaging Het
Slc44a5 A G 3: 154,256,584 T385A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc7a1 T A 5: 148,352,399 M13L probably benign Het
Snrpb2 A G 2: 143,070,973 N172S possibly damaging Het
Spns1 G T 7: 126,374,302 probably benign Het
Srsf6 T A 2: 162,933,427 S86R probably benign Het
Stk25 A T 1: 93,625,656 probably benign Het
Szt2 A T 4: 118,397,669 C275S probably benign Het
Tcp10b T A 17: 13,073,617 probably null Het
Tmem248 T A 5: 130,231,774 L60H probably damaging Het
Trim27 T C 13: 21,183,760 I182T probably damaging Het
Tspan10 A G 11: 120,444,498 N145D probably damaging Het
Uhrf1bp1 T A 17: 27,890,105 F1099L probably benign Het
Vps13d A G 4: 145,074,842 F487S probably damaging Het
Wdr86 A T 5: 24,718,231 D154E probably benign Het
Wfdc18 C A 11: 83,709,869 A32D possibly damaging Het
Wrn A T 8: 33,335,991 probably null Het
Zfp811 C A 17: 32,800,923 E7* probably null Het
Other mutations in Olfr347
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02190:Olfr347 APN 2 36734579 missense probably benign 0.03
IGL02417:Olfr347 APN 2 36734344 missense probably benign 0.13
IGL02488:Olfr347 APN 2 36734350 missense probably benign 0.36
IGL02878:Olfr347 APN 2 36734477 missense probably damaging 1.00
IGL03354:Olfr347 APN 2 36734512 missense possibly damaging 0.87
IGL03354:Olfr347 APN 2 36734513 missense possibly damaging 0.89
PIT4403001:Olfr347 UTSW 2 36734918 missense probably damaging 0.99
R0091:Olfr347 UTSW 2 36734905 missense probably damaging 1.00
R0107:Olfr347 UTSW 2 36734718 nonsense probably null
R0457:Olfr347 UTSW 2 36734533 missense probably benign 0.18
R0563:Olfr347 UTSW 2 36735001 nonsense probably null
R1205:Olfr347 UTSW 2 36734755 missense probably benign 0.16
R1599:Olfr347 UTSW 2 36734989 missense probably benign 0.01
R1668:Olfr347 UTSW 2 36735192 nonsense probably null
R1845:Olfr347 UTSW 2 36734842 missense probably damaging 0.99
R1856:Olfr347 UTSW 2 36734345 missense probably benign
R2165:Olfr347 UTSW 2 36734701 missense probably damaging 0.97
R4399:Olfr347 UTSW 2 36735230 missense probably benign 0.00
R4684:Olfr347 UTSW 2 36734674 missense probably damaging 1.00
R4767:Olfr347 UTSW 2 36734323 start codon destroyed probably benign 0.02
R4988:Olfr347 UTSW 2 36734984 missense possibly damaging 0.94
R5058:Olfr347 UTSW 2 36734999 missense possibly damaging 0.52
R5103:Olfr347 UTSW 2 36734668 missense probably benign 0.23
R5140:Olfr347 UTSW 2 36734498 missense possibly damaging 0.59
R5587:Olfr347 UTSW 2 36734621 missense probably damaging 1.00
R5591:Olfr347 UTSW 2 36735232 missense probably benign
R6738:Olfr347 UTSW 2 36734432 missense probably benign 0.26
R7097:Olfr347 UTSW 2 36734424 missense probably benign 0.02
R7122:Olfr347 UTSW 2 36734424 missense probably benign 0.02
R7330:Olfr347 UTSW 2 36735045 nonsense probably null
R7485:Olfr347 UTSW 2 36734638 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTGAGAAAGATCTTCACTTTTGG -3'
(R):5'- TGTGTCAGCATATTCATGAGCATC -3'

Sequencing Primer
(F):5'- CTCCTTTCACTCACAGAAGA -3'
(R):5'- GCATATTCATGAGCATCTTTGGAGC -3'
Posted On2015-10-08