Incidental Mutation 'R4657:Myo3b'
ID352490
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission 041917-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4657 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70238899 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 494 (V494A)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060208
AA Change: V522A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: V522A

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112243
AA Change: V494A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: V494A

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,013,478 V264E possibly damaging Het
Abcg1 T A 17: 31,108,434 W368R probably benign Het
Acin1 A G 14: 54,643,047 I476T possibly damaging Het
Acsm1 T A 7: 119,640,694 I287N possibly damaging Het
Adgrv1 C T 13: 81,405,364 V5464I probably benign Het
AI429214 T A 8: 36,994,391 L231Q probably damaging Het
Akp3 A G 1: 87,125,834 probably benign Het
Amy2b C T 3: 113,153,477 noncoding transcript Het
Apoa5 A G 9: 46,269,872 Q82R probably benign Het
Arhgap44 A G 11: 65,005,452 probably null Het
Arhgef38 C A 3: 133,234,681 G48V probably damaging Het
Bod1l G T 5: 41,818,612 N1786K probably benign Het
Cav2 A T 6: 17,281,410 D17V probably null Het
Ccdc148 G T 2: 59,001,888 N238K probably benign Het
Ccin A T 4: 43,984,981 I463F probably damaging Het
Cd8b1 C T 6: 71,329,774 H162Y possibly damaging Het
Cdh16 T A 8: 104,615,226 probably null Het
Cfap65 T A 1: 74,925,354 probably benign Het
Clec4n T C 6: 123,232,196 probably null Het
Cpne7 T A 8: 123,134,575 *558R probably null Het
Cs A G 10: 128,353,137 I172V probably benign Het
Cyp2ab1 A T 16: 20,313,072 L306Q probably damaging Het
D16Ertd472e A T 16: 78,547,926 V98E probably damaging Het
Dcaf15 A C 8: 84,102,838 S92A probably damaging Het
Dkk3 T C 7: 112,149,046 probably null Het
Dnah11 A T 12: 118,192,427 C163S probably benign Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Eml4 A T 17: 83,450,948 K397* probably null Het
Eml6 A T 11: 29,805,108 I889N possibly damaging Het
Etaa1 A T 11: 17,946,964 D384E possibly damaging Het
Fzr1 T A 10: 81,367,552 probably null Het
Gm13889 G T 2: 93,956,576 F61L probably damaging Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gm5828 T A 1: 16,769,418 noncoding transcript Het
Gm5866 G A 5: 52,582,920 noncoding transcript Het
Gp2 T C 7: 119,457,168 I27M probably benign Het
Gpr83 G A 9: 14,866,983 probably null Het
Gucd1 T C 10: 75,511,125 N97S probably benign Het
H2-Q7 T A 17: 35,442,759 V326E possibly damaging Het
Haao A T 17: 83,832,345 D227E possibly damaging Het
Hipk3 C T 2: 104,433,759 S819N probably benign Het
Hist3h2ba C T 11: 58,948,971 P11L probably benign Het
Hlcs A G 16: 94,262,698 V501A probably benign Het
Hmcn1 A G 1: 150,624,550 Y3964H probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifi211 A G 1: 173,907,660 F68L probably benign Het
Ift57 A G 16: 49,762,594 probably null Het
Ighv5-12-4 A T 12: 113,762,267 L112* probably null Het
Il1f6 T A 2: 24,224,404 M97K possibly damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Itsn2 A G 12: 4,713,197 *1686W probably null Het
Jkamp G T 12: 72,094,049 V123F probably damaging Het
Kat7 C A 11: 95,277,598 V411L probably damaging Het
Kcnj5 A G 9: 32,322,677 V114A probably benign Het
Krtap5-4 T A 7: 142,303,754 C54S unknown Het
Lats1 T A 10: 7,705,684 N744K possibly damaging Het
Lpo T C 11: 87,814,347 E387G probably damaging Het
Lrba T G 3: 86,737,164 M388R probably damaging Het
Lrp2 C A 2: 69,466,993 R3208L probably damaging Het
Mterf1b T A 5: 4,197,176 C272* probably null Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh15 A T 16: 49,172,058 R1632* probably null Het
Myo9a T C 9: 59,875,416 probably null Het
Nelfa T G 5: 33,901,813 S233R probably benign Het
Nr4a3 A T 4: 48,051,522 E121V probably damaging Het
Obscn T A 11: 59,042,290 E5406D probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr347 T A 2: 36,734,403 Y27* probably null Het
Olfr873 A C 9: 20,300,623 H142P probably damaging Het
Oxct2b T C 4: 123,117,133 L282P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb14 A G 18: 37,448,847 I335M possibly damaging Het
Pcsk1 T A 13: 75,132,235 D726E probably damaging Het
Pkhd1 T A 1: 20,364,167 Q2349L possibly damaging Het
Pkhd1l1 G A 15: 44,547,347 C2750Y probably damaging Het
Ppp2r3d A G 9: 124,476,821 C26R unknown Het
Prex2 T A 1: 11,065,825 I74N probably benign Het
Ptgir A G 7: 16,907,146 D121G probably benign Het
Ralbp1 T C 17: 65,852,691 S526G probably null Het
Ric8b T C 10: 84,992,137 Y442H probably damaging Het
Rpap1 C T 2: 119,775,006 D385N probably benign Het
Sash1 T C 10: 8,725,660 Y1177C probably damaging Het
Shroom1 T C 11: 53,465,588 I363T possibly damaging Het
Slc26a9 T C 1: 131,753,138 L95P probably damaging Het
Slc44a5 A G 3: 154,256,584 T385A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc7a1 T A 5: 148,352,399 M13L probably benign Het
Snrpb2 A G 2: 143,070,973 N172S possibly damaging Het
Spns1 G T 7: 126,374,302 probably benign Het
Srsf6 T A 2: 162,933,427 S86R probably benign Het
Stk25 A T 1: 93,625,656 probably benign Het
Szt2 A T 4: 118,397,669 C275S probably benign Het
Tcp10b T A 17: 13,073,617 probably null Het
Tmem248 T A 5: 130,231,774 L60H probably damaging Het
Trim27 T C 13: 21,183,760 I182T probably damaging Het
Tspan10 A G 11: 120,444,498 N145D probably damaging Het
Uhrf1bp1 T A 17: 27,890,105 F1099L probably benign Het
Vps13d A G 4: 145,074,842 F487S probably damaging Het
Wdr86 A T 5: 24,718,231 D154E probably benign Het
Wfdc18 C A 11: 83,709,869 A32D possibly damaging Het
Wrn A T 8: 33,335,991 probably null Het
Zfp811 C A 17: 32,800,923 E7* probably null Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCAGCATCATTGGAGTG -3'
(R):5'- AAATCAGCTACCACTGCTCCTTTG -3'

Sequencing Primer
(F):5'- ATCATTGGAGTGCGGCCTC -3'
(R):5'- CTGCCTGCTGTATAACTC -3'
Posted On2015-10-08