Incidental Mutation 'R4657:Lrba'
ID352498
Institutional Source Beutler Lab
Gene Symbol Lrba
Ensembl Gene ENSMUSG00000028080
Gene NameLPS-responsive beige-like anchor
SynonymsLba, D3Ertd775e
MMRRC Submission 041917-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4657 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location86224680-86782692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86737164 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 388 (M388R)
Ref Sequence ENSEMBL: ENSMUSP00000141734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000195524]
Predicted Effect probably damaging
Transcript: ENSMUST00000107635
AA Change: M2484R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: M2484R

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192145
AA Change: M2484R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: M2484R

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194759
AA Change: M2484R

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: M2484R

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195524
AA Change: M388R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141734
Gene: ENSMUSG00000028080
AA Change: M388R

DomainStartEndE-ValueType
Pfam:PH_BEACH 3 76 3.6e-20 PFAM
Beach 107 384 2.87e-207 SMART
WD40 482 519 7.4e0 SMART
WD40 522 565 1.72e0 SMART
WD40 581 620 3.99e-1 SMART
WD40 664 702 1.79e-1 SMART
WD40 705 744 4.28e0 SMART
Meta Mutation Damage Score 0.52 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,013,478 V264E possibly damaging Het
Abcg1 T A 17: 31,108,434 W368R probably benign Het
Acin1 A G 14: 54,643,047 I476T possibly damaging Het
Acsm1 T A 7: 119,640,694 I287N possibly damaging Het
Adgrv1 C T 13: 81,405,364 V5464I probably benign Het
AI429214 T A 8: 36,994,391 L231Q probably damaging Het
Akp3 A G 1: 87,125,834 probably benign Het
Amy2b C T 3: 113,153,477 noncoding transcript Het
Apoa5 A G 9: 46,269,872 Q82R probably benign Het
Arhgap44 A G 11: 65,005,452 probably null Het
Arhgef38 C A 3: 133,234,681 G48V probably damaging Het
Bod1l G T 5: 41,818,612 N1786K probably benign Het
Cav2 A T 6: 17,281,410 D17V probably null Het
Ccdc148 G T 2: 59,001,888 N238K probably benign Het
Ccin A T 4: 43,984,981 I463F probably damaging Het
Cd8b1 C T 6: 71,329,774 H162Y possibly damaging Het
Cdh16 T A 8: 104,615,226 probably null Het
Cfap65 T A 1: 74,925,354 probably benign Het
Clec4n T C 6: 123,232,196 probably null Het
Cpne7 T A 8: 123,134,575 *558R probably null Het
Cs A G 10: 128,353,137 I172V probably benign Het
Cyp2ab1 A T 16: 20,313,072 L306Q probably damaging Het
D16Ertd472e A T 16: 78,547,926 V98E probably damaging Het
Dcaf15 A C 8: 84,102,838 S92A probably damaging Het
Dkk3 T C 7: 112,149,046 probably null Het
Dnah11 A T 12: 118,192,427 C163S probably benign Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Eml4 A T 17: 83,450,948 K397* probably null Het
Eml6 A T 11: 29,805,108 I889N possibly damaging Het
Etaa1 A T 11: 17,946,964 D384E possibly damaging Het
Fzr1 T A 10: 81,367,552 probably null Het
Gm13889 G T 2: 93,956,576 F61L probably damaging Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gm5828 T A 1: 16,769,418 noncoding transcript Het
Gm5866 G A 5: 52,582,920 noncoding transcript Het
Gp2 T C 7: 119,457,168 I27M probably benign Het
Gpr83 G A 9: 14,866,983 probably null Het
Gucd1 T C 10: 75,511,125 N97S probably benign Het
H2-Q7 T A 17: 35,442,759 V326E possibly damaging Het
Haao A T 17: 83,832,345 D227E possibly damaging Het
Hipk3 C T 2: 104,433,759 S819N probably benign Het
Hist3h2ba C T 11: 58,948,971 P11L probably benign Het
Hlcs A G 16: 94,262,698 V501A probably benign Het
Hmcn1 A G 1: 150,624,550 Y3964H probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifi211 A G 1: 173,907,660 F68L probably benign Het
Ift57 A G 16: 49,762,594 probably null Het
Ighv5-12-4 A T 12: 113,762,267 L112* probably null Het
Il1f6 T A 2: 24,224,404 M97K possibly damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Itsn2 A G 12: 4,713,197 *1686W probably null Het
Jkamp G T 12: 72,094,049 V123F probably damaging Het
Kat7 C A 11: 95,277,598 V411L probably damaging Het
Kcnj5 A G 9: 32,322,677 V114A probably benign Het
Krtap5-4 T A 7: 142,303,754 C54S unknown Het
Lats1 T A 10: 7,705,684 N744K possibly damaging Het
Lpo T C 11: 87,814,347 E387G probably damaging Het
Lrp2 C A 2: 69,466,993 R3208L probably damaging Het
Mterf1b T A 5: 4,197,176 C272* probably null Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh15 A T 16: 49,172,058 R1632* probably null Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo9a T C 9: 59,875,416 probably null Het
Nelfa T G 5: 33,901,813 S233R probably benign Het
Nr4a3 A T 4: 48,051,522 E121V probably damaging Het
Obscn T A 11: 59,042,290 E5406D probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr347 T A 2: 36,734,403 Y27* probably null Het
Olfr873 A C 9: 20,300,623 H142P probably damaging Het
Oxct2b T C 4: 123,117,133 L282P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb14 A G 18: 37,448,847 I335M possibly damaging Het
Pcsk1 T A 13: 75,132,235 D726E probably damaging Het
Pkhd1 T A 1: 20,364,167 Q2349L possibly damaging Het
Pkhd1l1 G A 15: 44,547,347 C2750Y probably damaging Het
Ppp2r3d A G 9: 124,476,821 C26R unknown Het
Prex2 T A 1: 11,065,825 I74N probably benign Het
Ptgir A G 7: 16,907,146 D121G probably benign Het
Ralbp1 T C 17: 65,852,691 S526G probably null Het
Ric8b T C 10: 84,992,137 Y442H probably damaging Het
Rpap1 C T 2: 119,775,006 D385N probably benign Het
Sash1 T C 10: 8,725,660 Y1177C probably damaging Het
Shroom1 T C 11: 53,465,588 I363T possibly damaging Het
Slc26a9 T C 1: 131,753,138 L95P probably damaging Het
Slc44a5 A G 3: 154,256,584 T385A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc7a1 T A 5: 148,352,399 M13L probably benign Het
Snrpb2 A G 2: 143,070,973 N172S possibly damaging Het
Spns1 G T 7: 126,374,302 probably benign Het
Srsf6 T A 2: 162,933,427 S86R probably benign Het
Stk25 A T 1: 93,625,656 probably benign Het
Szt2 A T 4: 118,397,669 C275S probably benign Het
Tcp10b T A 17: 13,073,617 probably null Het
Tmem248 T A 5: 130,231,774 L60H probably damaging Het
Trim27 T C 13: 21,183,760 I182T probably damaging Het
Tspan10 A G 11: 120,444,498 N145D probably damaging Het
Uhrf1bp1 T A 17: 27,890,105 F1099L probably benign Het
Vps13d A G 4: 145,074,842 F487S probably damaging Het
Wdr86 A T 5: 24,718,231 D154E probably benign Het
Wfdc18 C A 11: 83,709,869 A32D possibly damaging Het
Wrn A T 8: 33,335,991 probably null Het
Zfp811 C A 17: 32,800,923 E7* probably null Het
Other mutations in Lrba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lrba APN 3 86359782 missense probably benign 0.00
IGL00788:Lrba APN 3 86327685 missense probably damaging 0.97
IGL01139:Lrba APN 3 86642662 missense possibly damaging 0.88
IGL01302:Lrba APN 3 86295400 missense probably damaging 1.00
IGL01612:Lrba APN 3 86776177 missense possibly damaging 0.89
IGL01718:Lrba APN 3 86351248 missense probably damaging 1.00
IGL01719:Lrba APN 3 86327596 splice site probably benign
IGL01730:Lrba APN 3 86741424 missense possibly damaging 0.89
IGL01735:Lrba APN 3 86327661 missense probably benign 0.28
IGL01875:Lrba APN 3 86310047 missense probably damaging 1.00
IGL01884:Lrba APN 3 86310412 missense possibly damaging 0.86
IGL02264:Lrba APN 3 86780262 missense probably damaging 0.99
IGL02638:Lrba APN 3 86325073 missense probably damaging 0.97
IGL02647:Lrba APN 3 86359731 missense probably benign 0.00
IGL02664:Lrba APN 3 86325731 missense possibly damaging 0.84
IGL02728:Lrba APN 3 86776049 missense probably damaging 0.99
IGL02730:Lrba APN 3 86328199 missense probably damaging 1.00
IGL02883:Lrba APN 3 86354206 missense probably damaging 1.00
IGL02883:Lrba APN 3 86445413 missense probably damaging 0.99
IGL02948:Lrba APN 3 86310384 splice site probably null
IGL03090:Lrba APN 3 86773141 missense probably benign 0.01
molasses UTSW 3 86354307 critical splice donor site probably null
oscar UTSW 3 86350304 nonsense probably null
oscar2 UTSW 3 86664458 nonsense probably null
P0023:Lrba UTSW 3 86417935 missense probably damaging 1.00
PIT4802001:Lrba UTSW 3 86664494 nonsense probably null
R0077:Lrba UTSW 3 86542688 missense probably damaging 0.99
R0189:Lrba UTSW 3 86368509 missense probably damaging 1.00
R0217:Lrba UTSW 3 86642722 missense probably damaging 1.00
R0349:Lrba UTSW 3 86540005 missense probably damaging 1.00
R0396:Lrba UTSW 3 86295179 missense probably damaging 1.00
R0417:Lrba UTSW 3 86715654 missense probably damaging 1.00
R0536:Lrba UTSW 3 86715532 missense probably damaging 1.00
R0712:Lrba UTSW 3 86297990 nonsense probably null
R0722:Lrba UTSW 3 86605989 critical splice donor site probably null
R0828:Lrba UTSW 3 86608370 synonymous probably null
R0927:Lrba UTSW 3 86780233 missense probably damaging 1.00
R1120:Lrba UTSW 3 86295192 missense probably damaging 1.00
R1141:Lrba UTSW 3 86619558 missense probably damaging 1.00
R1276:Lrba UTSW 3 86664526 missense probably damaging 1.00
R1449:Lrba UTSW 3 86354278 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1474:Lrba UTSW 3 86780266 splice site probably benign
R1558:Lrba UTSW 3 86351315 missense probably damaging 1.00
R1596:Lrba UTSW 3 86350304 nonsense probably null
R1652:Lrba UTSW 3 86539938 missense probably damaging 1.00
R1800:Lrba UTSW 3 86351868 missense probably benign 0.00
R1819:Lrba UTSW 3 86542634 missense possibly damaging 0.80
R1862:Lrba UTSW 3 86773203 critical splice donor site probably null
R1917:Lrba UTSW 3 86664501 missense probably damaging 1.00
R1965:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1966:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1969:Lrba UTSW 3 86608389 missense probably damaging 0.99
R2011:Lrba UTSW 3 86310017 missense probably damaging 0.99
R2179:Lrba UTSW 3 86354281 missense probably damaging 1.00
R2186:Lrba UTSW 3 86304336 missense probably damaging 1.00
R2281:Lrba UTSW 3 86776103 missense possibly damaging 0.46
R2359:Lrba UTSW 3 86348750 missense probably benign 0.01
R2412:Lrba UTSW 3 86327700 missense probably damaging 1.00
R2496:Lrba UTSW 3 86532087 missense probably damaging 1.00
R3153:Lrba UTSW 3 86285219 missense probably damaging 0.99
R3708:Lrba UTSW 3 86285024 missense possibly damaging 0.80
R3746:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3747:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3748:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3749:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3750:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3758:Lrba UTSW 3 86776049 missense probably damaging 0.99
R3975:Lrba UTSW 3 86351255 missense probably damaging 1.00
R4210:Lrba UTSW 3 86360126 missense probably damaging 1.00
R4258:Lrba UTSW 3 86445349 missense probably damaging 1.00
R4713:Lrba UTSW 3 86359868 missense probably benign 0.13
R4716:Lrba UTSW 3 86642714 missense probably damaging 0.99
R4811:Lrba UTSW 3 86776141 missense probably damaging 1.00
R4827:Lrba UTSW 3 86360150 missense possibly damaging 0.85
R4840:Lrba UTSW 3 86619509 critical splice acceptor site probably null
R4920:Lrba UTSW 3 86664458 nonsense probably null
R4948:Lrba UTSW 3 86285028 missense probably damaging 1.00
R4970:Lrba UTSW 3 86225371 missense probably benign 0.23
R4985:Lrba UTSW 3 86327436 intron probably null
R4993:Lrba UTSW 3 86360037 missense probably damaging 1.00
R5107:Lrba UTSW 3 86359779 missense possibly damaging 0.47
R5112:Lrba UTSW 3 86225371 missense probably benign 0.23
R5122:Lrba UTSW 3 86349154 nonsense probably null
R5155:Lrba UTSW 3 86351300 missense probably benign 0.25
R5194:Lrba UTSW 3 86328219 missense probably damaging 1.00
R5280:Lrba UTSW 3 86325022 missense possibly damaging 0.94
R5445:Lrba UTSW 3 86368595 missense probably benign
R5469:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5513:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5578:Lrba UTSW 3 86757507 missense probably benign 0.27
R5740:Lrba UTSW 3 86328342 missense probably damaging 1.00
R5868:Lrba UTSW 3 86319604 missense probably damaging 1.00
R6104:Lrba UTSW 3 86353792 missense probably damaging 1.00
R6166:Lrba UTSW 3 86354307 critical splice donor site probably null
R6279:Lrba UTSW 3 86348864 missense probably benign 0.26
R6330:Lrba UTSW 3 86348357 missense probably benign 0.07
R6367:Lrba UTSW 3 86368562 missense probably benign 0.42
R6571:Lrba UTSW 3 86360060 missense probably damaging 1.00
R6584:Lrba UTSW 3 86664576 missense probably damaging 1.00
R6698:Lrba UTSW 3 86304425 missense probably damaging 0.99
R6763:Lrba UTSW 3 86354263 missense probably damaging 1.00
R6834:Lrba UTSW 3 86350286 missense probably benign 0.00
R6951:Lrba UTSW 3 86745873 missense probably benign 0.01
R6969:Lrba UTSW 3 86619590 missense probably benign 0.21
R7045:Lrba UTSW 3 86285091 missense probably benign 0.03
R7133:Lrba UTSW 3 86394931 intron probably null
R7182:Lrba UTSW 3 86741458 frame shift probably null
R7214:Lrba UTSW 3 86328326 missense probably damaging 1.00
R7224:Lrba UTSW 3 86395246 missense probably damaging 1.00
R7243:Lrba UTSW 3 86751516 splice site probably null
R7350:Lrba UTSW 3 86351902 missense probably damaging 0.96
R7380:Lrba UTSW 3 86325074 missense probably damaging 1.00
R7492:Lrba UTSW 3 86664528 missense probably damaging 1.00
X0065:Lrba UTSW 3 86297899 missense probably damaging 1.00
X0065:Lrba UTSW 3 86325089 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCCGTAGAAACATGGGTTG -3'
(R):5'- TGAGCACTGTAGCTAAATTTGC -3'

Sequencing Primer
(F):5'- CCCGTAGAAACATGGGTTGATTTTC -3'
(R):5'- GCTTTCTCATGACCTAGGGAG -3'
Posted On2015-10-08