Incidental Mutation 'R4657:Itsn2'
ID352546
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission 041917-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4657 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 4713197 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 1686 (*1686W)
Ref Sequence ENSEMBL: ENSMUSP00000151896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000111154] [ENSMUST00000219007] [ENSMUST00000220311] [ENSMUST00000220978] [ENSMUST00000222363]
Predicted Effect probably null
Transcript: ENSMUST00000062580
AA Change: *1659W
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: *1659W

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218211
Predicted Effect probably null
Transcript: ENSMUST00000219007
AA Change: *1659W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect probably null
Transcript: ENSMUST00000220311
AA Change: *1686W
Predicted Effect probably benign
Transcript: ENSMUST00000220978
Predicted Effect probably benign
Transcript: ENSMUST00000222363
Meta Mutation Damage Score 0.542 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,013,478 V264E possibly damaging Het
Abcg1 T A 17: 31,108,434 W368R probably benign Het
Acin1 A G 14: 54,643,047 I476T possibly damaging Het
Acsm1 T A 7: 119,640,694 I287N possibly damaging Het
Adgrv1 C T 13: 81,405,364 V5464I probably benign Het
AI429214 T A 8: 36,994,391 L231Q probably damaging Het
Akp3 A G 1: 87,125,834 probably benign Het
Amy2b C T 3: 113,153,477 noncoding transcript Het
Apoa5 A G 9: 46,269,872 Q82R probably benign Het
Arhgap44 A G 11: 65,005,452 probably null Het
Arhgef38 C A 3: 133,234,681 G48V probably damaging Het
Bod1l G T 5: 41,818,612 N1786K probably benign Het
Cav2 A T 6: 17,281,410 D17V probably null Het
Ccdc148 G T 2: 59,001,888 N238K probably benign Het
Ccin A T 4: 43,984,981 I463F probably damaging Het
Cd8b1 C T 6: 71,329,774 H162Y possibly damaging Het
Cdh16 T A 8: 104,615,226 probably null Het
Cfap65 T A 1: 74,925,354 probably benign Het
Clec4n T C 6: 123,232,196 probably null Het
Cpne7 T A 8: 123,134,575 *558R probably null Het
Cs A G 10: 128,353,137 I172V probably benign Het
Cyp2ab1 A T 16: 20,313,072 L306Q probably damaging Het
D16Ertd472e A T 16: 78,547,926 V98E probably damaging Het
Dcaf15 A C 8: 84,102,838 S92A probably damaging Het
Dkk3 T C 7: 112,149,046 probably null Het
Dnah11 A T 12: 118,192,427 C163S probably benign Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Eml4 A T 17: 83,450,948 K397* probably null Het
Eml6 A T 11: 29,805,108 I889N possibly damaging Het
Etaa1 A T 11: 17,946,964 D384E possibly damaging Het
Fzr1 T A 10: 81,367,552 probably null Het
Gm13889 G T 2: 93,956,576 F61L probably damaging Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gm5828 T A 1: 16,769,418 noncoding transcript Het
Gm5866 G A 5: 52,582,920 noncoding transcript Het
Gp2 T C 7: 119,457,168 I27M probably benign Het
Gpr83 G A 9: 14,866,983 probably null Het
Gucd1 T C 10: 75,511,125 N97S probably benign Het
H2-Q7 T A 17: 35,442,759 V326E possibly damaging Het
Haao A T 17: 83,832,345 D227E possibly damaging Het
Hipk3 C T 2: 104,433,759 S819N probably benign Het
Hist3h2ba C T 11: 58,948,971 P11L probably benign Het
Hlcs A G 16: 94,262,698 V501A probably benign Het
Hmcn1 A G 1: 150,624,550 Y3964H probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifi211 A G 1: 173,907,660 F68L probably benign Het
Ift57 A G 16: 49,762,594 probably null Het
Ighv5-12-4 A T 12: 113,762,267 L112* probably null Het
Il1f6 T A 2: 24,224,404 M97K possibly damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Jkamp G T 12: 72,094,049 V123F probably damaging Het
Kat7 C A 11: 95,277,598 V411L probably damaging Het
Kcnj5 A G 9: 32,322,677 V114A probably benign Het
Krtap5-4 T A 7: 142,303,754 C54S unknown Het
Lats1 T A 10: 7,705,684 N744K possibly damaging Het
Lpo T C 11: 87,814,347 E387G probably damaging Het
Lrba T G 3: 86,737,164 M388R probably damaging Het
Lrp2 C A 2: 69,466,993 R3208L probably damaging Het
Mterf1b T A 5: 4,197,176 C272* probably null Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh15 A T 16: 49,172,058 R1632* probably null Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo9a T C 9: 59,875,416 probably null Het
Nelfa T G 5: 33,901,813 S233R probably benign Het
Nr4a3 A T 4: 48,051,522 E121V probably damaging Het
Obscn T A 11: 59,042,290 E5406D probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr347 T A 2: 36,734,403 Y27* probably null Het
Olfr873 A C 9: 20,300,623 H142P probably damaging Het
Oxct2b T C 4: 123,117,133 L282P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb14 A G 18: 37,448,847 I335M possibly damaging Het
Pcsk1 T A 13: 75,132,235 D726E probably damaging Het
Pkhd1 T A 1: 20,364,167 Q2349L possibly damaging Het
Pkhd1l1 G A 15: 44,547,347 C2750Y probably damaging Het
Ppp2r3d A G 9: 124,476,821 C26R unknown Het
Prex2 T A 1: 11,065,825 I74N probably benign Het
Ptgir A G 7: 16,907,146 D121G probably benign Het
Ralbp1 T C 17: 65,852,691 S526G probably null Het
Ric8b T C 10: 84,992,137 Y442H probably damaging Het
Rpap1 C T 2: 119,775,006 D385N probably benign Het
Sash1 T C 10: 8,725,660 Y1177C probably damaging Het
Shroom1 T C 11: 53,465,588 I363T possibly damaging Het
Slc26a9 T C 1: 131,753,138 L95P probably damaging Het
Slc44a5 A G 3: 154,256,584 T385A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc7a1 T A 5: 148,352,399 M13L probably benign Het
Snrpb2 A G 2: 143,070,973 N172S possibly damaging Het
Spns1 G T 7: 126,374,302 probably benign Het
Srsf6 T A 2: 162,933,427 S86R probably benign Het
Stk25 A T 1: 93,625,656 probably benign Het
Szt2 A T 4: 118,397,669 C275S probably benign Het
Tcp10b T A 17: 13,073,617 probably null Het
Tmem248 T A 5: 130,231,774 L60H probably damaging Het
Trim27 T C 13: 21,183,760 I182T probably damaging Het
Tspan10 A G 11: 120,444,498 N145D probably damaging Het
Uhrf1bp1 T A 17: 27,890,105 F1099L probably benign Het
Vps13d A G 4: 145,074,842 F487S probably damaging Het
Wdr86 A T 5: 24,718,231 D154E probably benign Het
Wfdc18 C A 11: 83,709,869 A32D possibly damaging Het
Wrn A T 8: 33,335,991 probably null Het
Zfp811 C A 17: 32,800,923 E7* probably null Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAACAAAGATATCTGATGCTCAC -3'
(R):5'- CACTAGTACAAGGCACTGTGC -3'

Sequencing Primer
(F):5'- CACATGATGTTTATTCCCCAGAC -3'
(R):5'- ACAAGGCACTGTGCTGTGG -3'
Posted On2015-10-08