Incidental Mutation 'R4657:Pkhd1l1'
ID352555
Institutional Source Beutler Lab
Gene Symbol Pkhd1l1
Ensembl Gene ENSMUSG00000038725
Gene Namepolycystic kidney and hepatic disease 1-like 1
SynonymsPKHDL1, D86 mRNA, fibrocystin L
MMRRC Submission 041917-MU
Accession Numbers

Genbank: NM_138674; MGI: 2183153

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4657 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location44457494-44601369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44547347 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 2750 (C2750Y)
Ref Sequence ENSEMBL: ENSMUSP00000036988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]
Predicted Effect probably damaging
Transcript: ENSMUST00000038336
AA Change: C2750Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: C2750Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 1.6e-16 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1322 1.1e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 5.1e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 2.1e-10 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166957
AA Change: C2750Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: C2750Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 9.4e-18 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1323 3e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 3.7e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 9.7e-12 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209244
AA Change: C2750Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (105/107)
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A T 11: 120,013,478 V264E possibly damaging Het
Abcg1 T A 17: 31,108,434 W368R probably benign Het
Acin1 A G 14: 54,643,047 I476T possibly damaging Het
Acsm1 T A 7: 119,640,694 I287N possibly damaging Het
Adgrv1 C T 13: 81,405,364 V5464I probably benign Het
AI429214 T A 8: 36,994,391 L231Q probably damaging Het
Akp3 A G 1: 87,125,834 probably benign Het
Amy2b C T 3: 113,153,477 noncoding transcript Het
Apoa5 A G 9: 46,269,872 Q82R probably benign Het
Arhgap44 A G 11: 65,005,452 probably null Het
Arhgef38 C A 3: 133,234,681 G48V probably damaging Het
Bod1l G T 5: 41,818,612 N1786K probably benign Het
Cav2 A T 6: 17,281,410 D17V probably null Het
Ccdc148 G T 2: 59,001,888 N238K probably benign Het
Ccin A T 4: 43,984,981 I463F probably damaging Het
Cd8b1 C T 6: 71,329,774 H162Y possibly damaging Het
Cdh16 T A 8: 104,615,226 probably null Het
Cfap65 T A 1: 74,925,354 probably benign Het
Clec4n T C 6: 123,232,196 probably null Het
Cpne7 T A 8: 123,134,575 *558R probably null Het
Cs A G 10: 128,353,137 I172V probably benign Het
Cyp2ab1 A T 16: 20,313,072 L306Q probably damaging Het
D16Ertd472e A T 16: 78,547,926 V98E probably damaging Het
Dcaf15 A C 8: 84,102,838 S92A probably damaging Het
Dkk3 T C 7: 112,149,046 probably null Het
Dnah11 A T 12: 118,192,427 C163S probably benign Het
Eda2r T A X: 97,341,633 Q171L probably damaging Het
Eml4 A T 17: 83,450,948 K397* probably null Het
Eml6 A T 11: 29,805,108 I889N possibly damaging Het
Etaa1 A T 11: 17,946,964 D384E possibly damaging Het
Fzr1 T A 10: 81,367,552 probably null Het
Gm13889 G T 2: 93,956,576 F61L probably damaging Het
Gm14149 A T 2: 151,230,764 noncoding transcript Het
Gm5828 T A 1: 16,769,418 noncoding transcript Het
Gm5866 G A 5: 52,582,920 noncoding transcript Het
Gp2 T C 7: 119,457,168 I27M probably benign Het
Gpr83 G A 9: 14,866,983 probably null Het
Gucd1 T C 10: 75,511,125 N97S probably benign Het
H2-Q7 T A 17: 35,442,759 V326E possibly damaging Het
Haao A T 17: 83,832,345 D227E possibly damaging Het
Hipk3 C T 2: 104,433,759 S819N probably benign Het
Hist3h2ba C T 11: 58,948,971 P11L probably benign Het
Hlcs A G 16: 94,262,698 V501A probably benign Het
Hmcn1 A G 1: 150,624,550 Y3964H probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ifi211 A G 1: 173,907,660 F68L probably benign Het
Ift57 A G 16: 49,762,594 probably null Het
Ighv5-12-4 A T 12: 113,762,267 L112* probably null Het
Il1f6 T A 2: 24,224,404 M97K possibly damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,327,310 probably benign Het
Itsn2 A G 12: 4,713,197 *1686W probably null Het
Jkamp G T 12: 72,094,049 V123F probably damaging Het
Kat7 C A 11: 95,277,598 V411L probably damaging Het
Kcnj5 A G 9: 32,322,677 V114A probably benign Het
Krtap5-4 T A 7: 142,303,754 C54S unknown Het
Lats1 T A 10: 7,705,684 N744K possibly damaging Het
Lpo T C 11: 87,814,347 E387G probably damaging Het
Lrba T G 3: 86,737,164 M388R probably damaging Het
Lrp2 C A 2: 69,466,993 R3208L probably damaging Het
Mterf1b T A 5: 4,197,176 C272* probably null Het
Mum1 T A 10: 80,233,014 C331S probably benign Het
Myh15 A T 16: 49,172,058 R1632* probably null Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Myo9a T C 9: 59,875,416 probably null Het
Nelfa T G 5: 33,901,813 S233R probably benign Het
Nr4a3 A T 4: 48,051,522 E121V probably damaging Het
Obscn T A 11: 59,042,290 E5406D probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr347 T A 2: 36,734,403 Y27* probably null Het
Olfr873 A C 9: 20,300,623 H142P probably damaging Het
Oxct2b T C 4: 123,117,133 L282P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb14 A G 18: 37,448,847 I335M possibly damaging Het
Pcsk1 T A 13: 75,132,235 D726E probably damaging Het
Pkhd1 T A 1: 20,364,167 Q2349L possibly damaging Het
Ppp2r3d A G 9: 124,476,821 C26R unknown Het
Prex2 T A 1: 11,065,825 I74N probably benign Het
Ptgir A G 7: 16,907,146 D121G probably benign Het
Ralbp1 T C 17: 65,852,691 S526G probably null Het
Ric8b T C 10: 84,992,137 Y442H probably damaging Het
Rpap1 C T 2: 119,775,006 D385N probably benign Het
Sash1 T C 10: 8,725,660 Y1177C probably damaging Het
Shroom1 T C 11: 53,465,588 I363T possibly damaging Het
Slc26a9 T C 1: 131,753,138 L95P probably damaging Het
Slc44a5 A G 3: 154,256,584 T385A possibly damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc7a1 T A 5: 148,352,399 M13L probably benign Het
Snrpb2 A G 2: 143,070,973 N172S possibly damaging Het
Spns1 G T 7: 126,374,302 probably benign Het
Srsf6 T A 2: 162,933,427 S86R probably benign Het
Stk25 A T 1: 93,625,656 probably benign Het
Szt2 A T 4: 118,397,669 C275S probably benign Het
Tcp10b T A 17: 13,073,617 probably null Het
Tmem248 T A 5: 130,231,774 L60H probably damaging Het
Trim27 T C 13: 21,183,760 I182T probably damaging Het
Tspan10 A G 11: 120,444,498 N145D probably damaging Het
Uhrf1bp1 T A 17: 27,890,105 F1099L probably benign Het
Vps13d A G 4: 145,074,842 F487S probably damaging Het
Wdr86 A T 5: 24,718,231 D154E probably benign Het
Wfdc18 C A 11: 83,709,869 A32D possibly damaging Het
Wrn A T 8: 33,335,991 probably null Het
Zfp811 C A 17: 32,800,923 E7* probably null Het
Other mutations in Pkhd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pkhd1l1 APN 15 44477586 missense probably damaging 1.00
IGL00235:Pkhd1l1 APN 15 44556019 missense probably damaging 1.00
IGL00264:Pkhd1l1 APN 15 44491029 missense possibly damaging 0.67
IGL00537:Pkhd1l1 APN 15 44591992 missense possibly damaging 0.88
IGL00537:Pkhd1l1 APN 15 44500047 missense probably benign 0.42
IGL00580:Pkhd1l1 APN 15 44586474 missense probably damaging 0.98
IGL01085:Pkhd1l1 APN 15 44562752 splice site probably null
IGL01089:Pkhd1l1 APN 15 44483869 splice site probably benign
IGL01094:Pkhd1l1 APN 15 44546929 missense probably benign 0.09
IGL01120:Pkhd1l1 APN 15 44505312 critical splice donor site probably null
IGL01307:Pkhd1l1 APN 15 44530029 missense possibly damaging 0.82
IGL01362:Pkhd1l1 APN 15 44532982 missense probably benign 0.00
IGL01403:Pkhd1l1 APN 15 44483833 nonsense probably null
IGL01546:Pkhd1l1 APN 15 44566316 missense probably damaging 1.00
IGL01596:Pkhd1l1 APN 15 44529410 missense possibly damaging 0.50
IGL01696:Pkhd1l1 APN 15 44529351 missense possibly damaging 0.79
IGL01844:Pkhd1l1 APN 15 44499400 splice site probably benign
IGL02007:Pkhd1l1 APN 15 44533733 splice site probably benign
IGL02041:Pkhd1l1 APN 15 44493056 splice site probably null
IGL02171:Pkhd1l1 APN 15 44516146 missense possibly damaging 0.80
IGL02206:Pkhd1l1 APN 15 44512849 missense probably benign 0.08
IGL02266:Pkhd1l1 APN 15 44573614 missense probably damaging 1.00
IGL02487:Pkhd1l1 APN 15 44459426 missense possibly damaging 0.65
IGL02488:Pkhd1l1 APN 15 44558597 missense probably benign
IGL02522:Pkhd1l1 APN 15 44555902 missense possibly damaging 0.71
IGL02554:Pkhd1l1 APN 15 44578500 missense probably damaging 1.00
IGL02566:Pkhd1l1 APN 15 44526054 splice site probably null
IGL02602:Pkhd1l1 APN 15 44557931 missense probably damaging 1.00
IGL02606:Pkhd1l1 APN 15 44589456 missense probably benign 0.00
IGL02623:Pkhd1l1 APN 15 44584873 missense probably damaging 1.00
IGL02634:Pkhd1l1 APN 15 44539667 missense probably damaging 1.00
IGL02637:Pkhd1l1 APN 15 44564324 missense probably damaging 1.00
IGL02651:Pkhd1l1 APN 15 44483814 missense probably damaging 1.00
IGL02679:Pkhd1l1 APN 15 44530045 critical splice donor site probably null
IGL02684:Pkhd1l1 APN 15 44516209 critical splice donor site probably null
IGL02739:Pkhd1l1 APN 15 44540950 missense probably benign 0.11
IGL02831:Pkhd1l1 APN 15 44501493 missense probably benign 0.18
IGL02839:Pkhd1l1 APN 15 44529543 missense probably damaging 0.98
IGL02944:Pkhd1l1 APN 15 44501531 missense probably damaging 1.00
IGL02957:Pkhd1l1 APN 15 44512908 missense probably damaging 1.00
IGL03001:Pkhd1l1 APN 15 44558004 missense probably damaging 1.00
IGL03030:Pkhd1l1 APN 15 44591976 missense probably benign 0.00
IGL03030:Pkhd1l1 APN 15 44596902 missense probably benign 0.41
IGL03132:Pkhd1l1 APN 15 44574617 missense probably damaging 1.00
IGL03194:Pkhd1l1 APN 15 44518135 missense probably damaging 1.00
IGL03219:Pkhd1l1 APN 15 44596895 missense possibly damaging 0.62
IGL03236:Pkhd1l1 APN 15 44581826 missense probably damaging 1.00
IGL03266:Pkhd1l1 APN 15 44538952 missense probably damaging 1.00
IGL03276:Pkhd1l1 APN 15 44594584 missense possibly damaging 0.77
IGL03284:Pkhd1l1 APN 15 44547518 splice site probably benign
IGL03377:Pkhd1l1 APN 15 44484351 splice site probably null
K7371:Pkhd1l1 UTSW 15 44537442 missense possibly damaging 0.67
K7371:Pkhd1l1 UTSW 15 44500067 missense possibly damaging 0.94
N/A - 287:Pkhd1l1 UTSW 15 44582258 missense probably damaging 0.98
P4717OSA:Pkhd1l1 UTSW 15 44523499 missense probably benign 0.17
P4717OSA:Pkhd1l1 UTSW 15 44528247 missense probably damaging 1.00
R0007:Pkhd1l1 UTSW 15 44574398 splice site probably benign
R0020:Pkhd1l1 UTSW 15 44556872 missense probably damaging 1.00
R0034:Pkhd1l1 UTSW 15 44504009 missense probably benign 0.00
R0040:Pkhd1l1 UTSW 15 44573625 missense probably damaging 1.00
R0050:Pkhd1l1 UTSW 15 44573807 missense possibly damaging 0.79
R0050:Pkhd1l1 UTSW 15 44573807 missense possibly damaging 0.79
R0063:Pkhd1l1 UTSW 15 44529237 missense probably damaging 1.00
R0063:Pkhd1l1 UTSW 15 44529237 missense probably damaging 1.00
R0086:Pkhd1l1 UTSW 15 44556008 missense possibly damaging 0.94
R0103:Pkhd1l1 UTSW 15 44597141 missense probably benign
R0103:Pkhd1l1 UTSW 15 44597141 missense probably benign
R0127:Pkhd1l1 UTSW 15 44554605 missense probably damaging 0.99
R0226:Pkhd1l1 UTSW 15 44526784 missense possibly damaging 0.65
R0268:Pkhd1l1 UTSW 15 44597011 missense probably benign 0.15
R0294:Pkhd1l1 UTSW 15 44560435 missense probably benign 0.05
R0310:Pkhd1l1 UTSW 15 44522738 splice site probably benign
R0344:Pkhd1l1 UTSW 15 44597011 missense probably benign 0.15
R0449:Pkhd1l1 UTSW 15 44501519 missense probably damaging 1.00
R0492:Pkhd1l1 UTSW 15 44519690 missense probably benign 0.03
R0505:Pkhd1l1 UTSW 15 44589418 missense probably damaging 1.00
R0529:Pkhd1l1 UTSW 15 44526754 missense possibly damaging 0.62
R0543:Pkhd1l1 UTSW 15 44523491 critical splice acceptor site probably null
R0552:Pkhd1l1 UTSW 15 44489546 missense probably damaging 0.98
R0558:Pkhd1l1 UTSW 15 44484424 missense probably damaging 0.97
R0609:Pkhd1l1 UTSW 15 44467424 missense possibly damaging 0.48
R0619:Pkhd1l1 UTSW 15 44483838 missense probably damaging 1.00
R0727:Pkhd1l1 UTSW 15 44535788 missense possibly damaging 0.80
R0787:Pkhd1l1 UTSW 15 44529264 missense probably damaging 1.00
R0846:Pkhd1l1 UTSW 15 44495597 missense probably damaging 1.00
R0909:Pkhd1l1 UTSW 15 44538883 splice site probably null
R0942:Pkhd1l1 UTSW 15 44532959 missense probably benign 0.01
R1056:Pkhd1l1 UTSW 15 44591964 missense probably damaging 1.00
R1147:Pkhd1l1 UTSW 15 44537441 missense probably null 0.15
R1147:Pkhd1l1 UTSW 15 44537441 missense probably null 0.15
R1187:Pkhd1l1 UTSW 15 44498051 missense possibly damaging 0.65
R1328:Pkhd1l1 UTSW 15 44497996 missense probably benign 0.01
R1331:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1331:Pkhd1l1 UTSW 15 44589597 missense probably damaging 1.00
R1332:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1335:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1338:Pkhd1l1 UTSW 15 44526724 missense probably damaging 1.00
R1440:Pkhd1l1 UTSW 15 44540988 splice site probably benign
R1445:Pkhd1l1 UTSW 15 44505644 missense probably benign 0.32
R1458:Pkhd1l1 UTSW 15 44516115 missense probably benign 0.01
R1469:Pkhd1l1 UTSW 15 44536886 missense probably benign 0.45
R1469:Pkhd1l1 UTSW 15 44536886 missense probably benign 0.45
R1500:Pkhd1l1 UTSW 15 44545494 missense probably damaging 1.00
R1528:Pkhd1l1 UTSW 15 44526724 missense probably damaging 1.00
R1542:Pkhd1l1 UTSW 15 44528191 missense probably benign 0.44
R1568:Pkhd1l1 UTSW 15 44545501 splice site probably null
R1571:Pkhd1l1 UTSW 15 44526841 missense probably benign
R1572:Pkhd1l1 UTSW 15 44543473 missense probably benign 0.01
R1604:Pkhd1l1 UTSW 15 44467367 nonsense probably null
R1638:Pkhd1l1 UTSW 15 44597117 missense probably benign 0.06
R1639:Pkhd1l1 UTSW 15 44540955 missense probably damaging 0.99
R1737:Pkhd1l1 UTSW 15 44547509 critical splice donor site probably null
R1816:Pkhd1l1 UTSW 15 44528239 missense possibly damaging 0.91
R1826:Pkhd1l1 UTSW 15 44503345 missense possibly damaging 0.75
R1880:Pkhd1l1 UTSW 15 44525242 missense probably benign 0.13
R1930:Pkhd1l1 UTSW 15 44503337 missense possibly damaging 0.69
R1933:Pkhd1l1 UTSW 15 44540884 missense possibly damaging 0.48
R1938:Pkhd1l1 UTSW 15 44500038 missense probably benign
R1975:Pkhd1l1 UTSW 15 44529713 missense probably damaging 1.00
R1999:Pkhd1l1 UTSW 15 44499982 intron probably null
R2037:Pkhd1l1 UTSW 15 44568221 splice site probably null
R2045:Pkhd1l1 UTSW 15 44479654 missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44547513 splice site probably benign
R2049:Pkhd1l1 UTSW 15 44581741 missense probably damaging 1.00
R2063:Pkhd1l1 UTSW 15 44550752 missense possibly damaging 0.69
R2072:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2073:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2075:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2078:Pkhd1l1 UTSW 15 44527767 missense probably benign 0.08
R2116:Pkhd1l1 UTSW 15 44569482 missense probably damaging 0.97
R2133:Pkhd1l1 UTSW 15 44516185 missense possibly damaging 0.91
R2138:Pkhd1l1 UTSW 15 44501457 missense probably damaging 1.00
R2139:Pkhd1l1 UTSW 15 44529818 missense possibly damaging 0.46
R2145:Pkhd1l1 UTSW 15 44512877 synonymous probably null
R2150:Pkhd1l1 UTSW 15 44499982 intron probably null
R2177:Pkhd1l1 UTSW 15 44459395 missense probably benign
R2184:Pkhd1l1 UTSW 15 44499296 missense possibly damaging 0.89
R2216:Pkhd1l1 UTSW 15 44573895 missense probably damaging 1.00
R2226:Pkhd1l1 UTSW 15 44512792 missense possibly damaging 0.79
R2227:Pkhd1l1 UTSW 15 44512792 missense possibly damaging 0.79
R2243:Pkhd1l1 UTSW 15 44546927 missense probably damaging 1.00
R2290:Pkhd1l1 UTSW 15 44528250 missense probably benign 0.03
R2294:Pkhd1l1 UTSW 15 44479607 missense probably damaging 0.99
R2346:Pkhd1l1 UTSW 15 44560506 missense possibly damaging 0.82
R2356:Pkhd1l1 UTSW 15 44533019 missense probably benign 0.00
R2386:Pkhd1l1 UTSW 15 44528178 missense probably benign 0.00
R2404:Pkhd1l1 UTSW 15 44550820 missense probably damaging 1.00
R2504:Pkhd1l1 UTSW 15 44485428 missense probably damaging 0.97
R2679:Pkhd1l1 UTSW 15 44545386 missense probably damaging 0.99
R2860:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2861:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2862:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2972:Pkhd1l1 UTSW 15 44547248 missense possibly damaging 0.65
R3016:Pkhd1l1 UTSW 15 44545370 missense probably benign 0.02
R3162:Pkhd1l1 UTSW 15 44505528 missense probably damaging 1.00
R3162:Pkhd1l1 UTSW 15 44505528 missense probably damaging 1.00
R3416:Pkhd1l1 UTSW 15 44547364 missense probably damaging 1.00
R3623:Pkhd1l1 UTSW 15 44526869 missense probably damaging 1.00
R3687:Pkhd1l1 UTSW 15 44546587 missense probably benign 0.17
R3755:Pkhd1l1 UTSW 15 44589406 missense probably damaging 1.00
R3776:Pkhd1l1 UTSW 15 44514975 critical splice donor site probably null
R3803:Pkhd1l1 UTSW 15 44493135 missense probably benign 0.25
R3942:Pkhd1l1 UTSW 15 44592026 critical splice donor site probably null
R4010:Pkhd1l1 UTSW 15 44529100 missense possibly damaging 0.80
R4049:Pkhd1l1 UTSW 15 44498557 missense probably damaging 1.00
R4059:Pkhd1l1 UTSW 15 44550760 missense probably benign 0.01
R4179:Pkhd1l1 UTSW 15 44523649 missense probably benign 0.45
R4184:Pkhd1l1 UTSW 15 44591906 missense probably benign 0.00
R4369:Pkhd1l1 UTSW 15 44505553 missense probably benign 0.00
R4462:Pkhd1l1 UTSW 15 44581804 missense probably damaging 1.00
R4551:Pkhd1l1 UTSW 15 44550885 missense probably damaging 1.00
R4618:Pkhd1l1 UTSW 15 44539682 missense probably damaging 1.00
R4632:Pkhd1l1 UTSW 15 44484400 missense probably benign 0.07
R4716:Pkhd1l1 UTSW 15 44556032 missense probably damaging 1.00
R4788:Pkhd1l1 UTSW 15 44498021 missense probably damaging 0.99
R4828:Pkhd1l1 UTSW 15 44529405 missense possibly damaging 0.55
R4858:Pkhd1l1 UTSW 15 44491101 missense probably damaging 0.99
R4860:Pkhd1l1 UTSW 15 44537378 missense possibly damaging 0.77
R4860:Pkhd1l1 UTSW 15 44537378 missense possibly damaging 0.77
R4951:Pkhd1l1 UTSW 15 44533891 missense possibly damaging 0.82
R4963:Pkhd1l1 UTSW 15 44504025 missense probably benign 0.00
R5023:Pkhd1l1 UTSW 15 44528191 missense probably benign 0.44
R5023:Pkhd1l1 UTSW 15 44582227 missense probably benign 0.00
R5035:Pkhd1l1 UTSW 15 44568324 missense probably damaging 1.00
R5049:Pkhd1l1 UTSW 15 44457616 missense probably benign 0.00
R5065:Pkhd1l1 UTSW 15 44582293 missense possibly damaging 0.68
R5089:Pkhd1l1 UTSW 15 44591887 missense probably benign 0.01
R5151:Pkhd1l1 UTSW 15 44505309 missense probably benign 0.00
R5153:Pkhd1l1 UTSW 15 44505309 missense probably benign 0.00
R5189:Pkhd1l1 UTSW 15 44547148 missense probably damaging 1.00
R5204:Pkhd1l1 UTSW 15 44547041 missense possibly damaging 0.51
R5216:Pkhd1l1 UTSW 15 44495647 nonsense probably null
R5286:Pkhd1l1 UTSW 15 44514972 nonsense probably null
R5292:Pkhd1l1 UTSW 15 44529566 missense probably damaging 1.00
R5293:Pkhd1l1 UTSW 15 44535750 missense probably benign 0.01
R5298:Pkhd1l1 UTSW 15 44504046 missense probably benign 0.00
R5327:Pkhd1l1 UTSW 15 44546862 missense probably damaging 1.00
R5346:Pkhd1l1 UTSW 15 44540967 missense probably damaging 1.00
R5481:Pkhd1l1 UTSW 15 44558646 missense probably damaging 1.00
R5645:Pkhd1l1 UTSW 15 44532992 missense probably benign 0.18
R5718:Pkhd1l1 UTSW 15 44545417 missense probably damaging 1.00
R5809:Pkhd1l1 UTSW 15 44519707 missense probably benign 0.03
R5816:Pkhd1l1 UTSW 15 44566322 missense probably benign 0.01
R5854:Pkhd1l1 UTSW 15 44581790 missense probably damaging 1.00
R5876:Pkhd1l1 UTSW 15 44578588 missense possibly damaging 0.51
R5909:Pkhd1l1 UTSW 15 44526763 missense probably damaging 1.00
R5950:Pkhd1l1 UTSW 15 44532965 missense probably benign 0.00
R5961:Pkhd1l1 UTSW 15 44459463 missense probably damaging 1.00
R5972:Pkhd1l1 UTSW 15 44545416 missense probably damaging 1.00
R5975:Pkhd1l1 UTSW 15 44525988 missense probably damaging 1.00
R5982:Pkhd1l1 UTSW 15 44489504 splice site probably null
R6066:Pkhd1l1 UTSW 15 44528129 missense probably damaging 0.99
R6122:Pkhd1l1 UTSW 15 44557940 missense probably damaging 1.00
R6248:Pkhd1l1 UTSW 15 44529559 missense probably benign
R6294:Pkhd1l1 UTSW 15 44570028 missense probably damaging 1.00
R6301:Pkhd1l1 UTSW 15 44589525 missense probably damaging 0.99
R6526:Pkhd1l1 UTSW 15 44498089 critical splice donor site probably null
R6707:Pkhd1l1 UTSW 15 44529143 missense probably benign
R6736:Pkhd1l1 UTSW 15 44557940 missense probably damaging 1.00
R6753:Pkhd1l1 UTSW 15 44589663 missense probably benign 0.45
R6815:Pkhd1l1 UTSW 15 44562655 missense probably damaging 1.00
R6874:Pkhd1l1 UTSW 15 44589527 missense probably benign 0.06
R6942:Pkhd1l1 UTSW 15 44522629 missense probably damaging 1.00
R6970:Pkhd1l1 UTSW 15 44511674 missense possibly damaging 0.61
R6982:Pkhd1l1 UTSW 15 44566268 missense probably damaging 0.97
R7103:Pkhd1l1 UTSW 15 44573631 missense probably benign 0.02
R7116:Pkhd1l1 UTSW 15 44557976 missense probably benign 0.00
R7135:Pkhd1l1 UTSW 15 44584978 critical splice donor site probably null
R7143:Pkhd1l1 UTSW 15 44573637 missense possibly damaging 0.93
R7177:Pkhd1l1 UTSW 15 44467404 missense probably damaging 1.00
R7194:Pkhd1l1 UTSW 15 44529116 missense probably damaging 1.00
R7204:Pkhd1l1 UTSW 15 44523553 missense possibly damaging 0.90
R7215:Pkhd1l1 UTSW 15 44528163 missense possibly damaging 0.78
R7218:Pkhd1l1 UTSW 15 44522695 missense possibly damaging 0.49
R7225:Pkhd1l1 UTSW 15 44546941 missense probably damaging 1.00
R7283:Pkhd1l1 UTSW 15 44503280 missense probably benign 0.10
R7292:Pkhd1l1 UTSW 15 44498590 missense probably benign
R7304:Pkhd1l1 UTSW 15 44498482 missense possibly damaging 0.94
R7349:Pkhd1l1 UTSW 15 44514954 missense probably damaging 1.00
R7359:Pkhd1l1 UTSW 15 44589486 missense probably damaging 1.00
R7407:Pkhd1l1 UTSW 15 44595011 missense possibly damaging 0.75
R7475:Pkhd1l1 UTSW 15 44505185 nonsense probably null
R7481:Pkhd1l1 UTSW 15 44512911 missense probably benign
R7554:Pkhd1l1 UTSW 15 44495470 missense probably damaging 1.00
R7555:Pkhd1l1 UTSW 15 44550761 missense possibly damaging 0.51
R7562:Pkhd1l1 UTSW 15 44514930 missense possibly damaging 0.68
X0027:Pkhd1l1 UTSW 15 44591966 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCCTGGCTCCCTATGTTGG -3'
(R):5'- ACTGGTGAATCAGCCTTAACC -3'

Sequencing Primer
(F):5'- CTCCCTATGTTGGAGGATGGG -3'
(R):5'- CTGGGATTGAATGCATGCATCACC -3'
Posted On2015-10-08