Incidental Mutation 'R4658:Samd4'
ID352628
Institutional Source Beutler Lab
Gene Symbol Samd4
Ensembl Gene ENSMUSG00000021838
Gene Namesterile alpha motif domain containing 4
Synonyms4933436G17Rik, 1700024G08Rik, Smaug, 1700111L17Rik
MMRRC Submission 041918-MU
Accession Numbers

Genbank: NM_001037221, NM_028966, NM_001163433

Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R4658 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location46882854-47105815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47064246 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 147 (R147C)
Ref Sequence ENSEMBL: ENSMUSP00000153846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022386] [ENSMUST00000100672] [ENSMUST00000125113] [ENSMUST00000125688] [ENSMUST00000137543] [ENSMUST00000228404]
Predicted Effect probably damaging
Transcript: ENSMUST00000022386
AA Change: R336C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022386
Gene: ENSMUSG00000021838
AA Change: R336C

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
SAM 320 383 1.4e-7 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100672
AA Change: R248C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098237
Gene: ENSMUSG00000021838
AA Change: R248C

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125113
AA Change: R235C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122833
Gene: ENSMUSG00000021838
AA Change: R235C

DomainStartEndE-ValueType
low complexity region 191 204 N/A INTRINSIC
SAM 219 282 1.4e-7 SMART
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125688
SMART Domains Protein: ENSMUSP00000115569
Gene: ENSMUSG00000021838

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137543
AA Change: R248C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114621
Gene: ENSMUSG00000021838
AA Change: R248C

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228404
AA Change: R147C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.482 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sterile alpha motifs (SAMs) in proteins such as SAMD4A are part of an RNA-binding domain that functions as a posttranscriptional regulator by binding to an RNA sequence motif known as the Smaug recognition element, which was named after the Drosophila Smaug protein (Baez and Boccaccio, 2005 [PubMed 16221671]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit leaness, myopathy and altered glucose metabolism. Mice homozygous for a spontaneous mutation exhibit kyphosis, abnormal gait, and decreased cortical bone thickness. [provided by MGI curators]
Allele List at MGI

ll alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,564 R778S probably damaging Het
Adam17 A G 12: 21,332,160 C567R probably damaging Het
Ankrd28 G A 14: 31,710,868 A758V probably damaging Het
Atrn T C 2: 130,933,429 Y151H probably damaging Het
B3gat3 A G 19: 8,925,632 T118A possibly damaging Het
Camta1 A G 4: 151,143,910 C822R probably damaging Het
Capn15 G T 17: 25,960,768 Q807K probably benign Het
Clec12a T C 6: 129,354,530 Y145H probably damaging Het
Clk1 T C 1: 58,412,987 I393V probably benign Het
Cpm A G 10: 117,668,051 I121V probably benign Het
Cux1 A G 5: 136,250,594 I405T possibly damaging Het
Dnah3 A G 7: 119,950,651 S3471P probably damaging Het
Dok6 A G 18: 89,473,847 probably benign Het
Eif4g1 A T 16: 20,685,934 D1124V possibly damaging Het
Eif4g3 A G 4: 138,206,132 E1756G probably damaging Het
Exo5 A G 4: 120,922,551 V39A probably benign Het
Fmnl1 A T 11: 103,197,694 I90F probably damaging Het
Fryl G T 5: 73,081,053 T1450K probably damaging Het
Gde1 T C 7: 118,694,528 M91V probably benign Het
Gimd1 T C 3: 132,644,582 I84T probably damaging Het
Gm13889 C T 2: 93,957,108 probably benign Het
Gm6445 T A 19: 9,608,197 noncoding transcript Het
Gm8113 T C 14: 43,932,410 S483P probably damaging Het
Grik2 T C 10: 49,523,792 I281V possibly damaging Het
Grik5 T C 7: 25,060,727 probably benign Het
Herc1 A T 9: 66,479,491 I3796F possibly damaging Het
Hoxb13 A T 11: 96,194,483 D14V probably benign Het
Hspg2 A G 4: 137,533,730 Y1645C probably damaging Het
Igkv8-16 G T 6: 70,386,778 R87S probably damaging Het
Ints1 A T 5: 139,774,299 V140E possibly damaging Het
Kbtbd11 C A 8: 15,028,917 D505E possibly damaging Het
Kcnu1 G A 8: 25,937,555 C300Y probably damaging Het
Kmt2d G C 15: 98,852,529 probably benign Het
Lats1 T C 10: 7,702,729 V539A probably benign Het
Lipo5 C T 19: 33,464,522 G200D unknown Het
Lmo7 C A 14: 101,886,957 A284D probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcpt8 T C 14: 56,083,828 M60V possibly damaging Het
Mdn1 A G 4: 32,730,749 probably null Het
Mphosph10 A G 7: 64,388,974 probably null Het
Muc5b G A 7: 141,841,398 S47N unknown Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Nr1d1 G A 11: 98,771,912 S85L possibly damaging Het
Obscn T A 11: 59,054,288 R4635* probably null Het
Olfr121 G T 17: 37,752,163 C103F probably damaging Het
Olfr1504 T C 19: 13,887,548 I221V probably benign Het
Olfr275 T C 4: 52,826,240 L281P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb17 G A 18: 37,486,599 G481S probably damaging Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Phf3 A T 1: 30,863,088 M48K probably damaging Het
Pira2 A T 7: 3,840,934 V613E probably damaging Het
Poc1a T C 9: 106,349,688 S327P possibly damaging Het
Ptpn9 A G 9: 57,020,037 H66R probably benign Het
Rabgap1 C T 2: 37,487,549 R353* probably null Het
Rcc1l G T 5: 134,171,890 N134K probably damaging Het
Rims1 G A 1: 22,427,543 T787I probably damaging Het
Rreb1 T G 13: 37,948,801 S1651A probably damaging Het
Rsl1d1 T C 16: 11,201,374 D100G probably damaging Het
Serpinb6e T C 13: 33,841,316 probably benign Het
Ska1 T C 18: 74,197,040 I210V probably benign Het
Slc17a1 A G 13: 23,878,560 I237V probably benign Het
Slc22a4 A T 11: 53,997,510 S231T probably benign Het
Slc7a4 T A 16: 17,575,933 M66L probably damaging Het
Snapc1 A G 12: 73,983,868 T381A possibly damaging Het
St6galnac2 C T 11: 116,684,525 probably benign Het
Taar2 C T 10: 23,941,503 L314F probably benign Het
Tmem74b A G 2: 151,706,641 D96G probably damaging Het
Tnfrsf17 T C 16: 11,313,969 F6S probably benign Het
Tpp2 G T 1: 43,954,710 G252W probably damaging Het
Trf A G 9: 103,223,608 F209L probably damaging Het
Ttn T C 2: 76,898,591 probably benign Het
Uhmk1 A T 1: 170,207,205 H311Q probably damaging Het
Unc13c G T 9: 73,932,826 Q248K probably damaging Het
Uqcrc2 A G 7: 120,650,921 Y253C probably damaging Het
Vmn2r117 A G 17: 23,478,416 F101L probably benign Het
Vmn2r43 T C 7: 8,255,071 N381S probably benign Het
Zfp879 T A 11: 50,833,197 Y271F probably damaging Het
Other mutations in Samd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Samd4 APN 14 47052898 missense probably damaging 1.00
IGL01413:Samd4 APN 14 47016792 missense probably benign 0.01
supermodel UTSW 14 47016337 missense probably damaging 1.00
B6584:Samd4 UTSW 14 47016337 missense probably damaging 1.00
G4846:Samd4 UTSW 14 47016319 missense probably damaging 1.00
R0096:Samd4 UTSW 14 47064297 missense possibly damaging 0.88
R0122:Samd4 UTSW 14 47016560 missense probably benign 0.44
R0562:Samd4 UTSW 14 47077509 missense probably damaging 1.00
R1247:Samd4 UTSW 14 47064328 critical splice donor site probably benign
R1247:Samd4 UTSW 14 47087758 small insertion probably benign
R1771:Samd4 UTSW 14 47089075 missense probably damaging 1.00
R1902:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R1903:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R2346:Samd4 UTSW 14 46884842 missense probably damaging 1.00
R4155:Samd4 UTSW 14 47052946 missense possibly damaging 0.74
R4498:Samd4 UTSW 14 47096109 missense probably damaging 1.00
R4510:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4511:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4871:Samd4 UTSW 14 47066463 missense probably damaging 1.00
R4991:Samd4 UTSW 14 47074010 missense probably damaging 0.97
R5432:Samd4 UTSW 14 47074062 missense probably benign 0.09
R5687:Samd4 UTSW 14 47016565 missense probably benign
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6254:Samd4 UTSW 14 47016631 missense probably damaging 1.00
R6366:Samd4 UTSW 14 47074150 critical splice donor site probably null
R6376:Samd4 UTSW 14 47052962 missense probably damaging 1.00
R6944:Samd4 UTSW 14 47016635 missense possibly damaging 0.94
R7035:Samd4 UTSW 14 47089163 synonymous silent
R7148:Samd4 UTSW 14 47016683 missense probably benign 0.09
X0018:Samd4 UTSW 14 47016696 missense possibly damaging 0.94
X0022:Samd4 UTSW 14 47074017 missense probably benign 0.45
Z0001:Samd4 UTSW 14 47016337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAAGTTAGCAATGCCTG -3'
(R):5'- AGGTCTGTTTCTGCATCTAAGAC -3'

Sequencing Primer
(F):5'- CCAAGGTTAGCCCTAATCTGTGAG -3'
(R):5'- ACAAGGTCTGTCTGATGCTGAACC -3'
Posted On2015-10-08